Search   Clear


Data pager
Data pager
Page size:
PageSizeComboBox
select
 354 items in 8 pages
PublicationData and Code Availability
Data pager
Data pager
Page size:
PageSizeComboBox
select
 354 items in 8 pages
PMID: 39727412

Title: Loss of mucin 2 and MHC II molecules causes rare resistance to murine RV infection.

Authors: Bomidi C, Sawyer FM, Shroyer N, Conner M, Estes MK, Blutt SE

Journal: J Virol

Publication Date: 2025 Feb 25

DOI: https://doi.org/10.1128/jvi.01507-24

MeSH Terms: Animals, Mice, Mice, Knockout, Rotavirus Infections, Goblet Cells, Mucin-2, Rotavirus, Histocompatibility Antigens Class II, Basic Helix-Loop-Helix Transcription Factors, Enterocytes, Paneth Cells, Disease Resistance, Mice, Inbred C57BL



Previously published sequencing data from scRNA-seq (29) are available on NCBI. The GEO accession number for the scRNA-seq data re-analyzed in this paper is GSE145827.
 Loss of mucin 2 and MHC II molecules causes rare resistance to murine RV infection.Bomidi C, Sawyer FM, Shroyer N, Conner M, Estes MK, Blutt SE2025 Feb 25 39727412
PMID: 39896606

Title: Dynamic Reprogramming of Stromal Pdgfra-expressing cells during WNT-Mediated Transformation of the Intestinal Epithelium.

Authors: Pellon-Cardenas O, Rout P, Hassan S, Fokas E, Ping H, Patel I, Patel J, Plotsker O, Wu A, Kumar R, Akther M, Logerfo A, Wu S, Wagner DE, Boffelli D, Walton KD, Manieri E, Tong K, Spence JR, Bessman NJ, Shivdasani RA, Verzi MP

Journal: bioRxiv

Publication Date: 2025 Jan 25

DOI: https://doi.org/10.1101/2025.01.22.634326

MeSH Terms: No Mesh Terms available



No data and code information found in the publication.
 Dynamic Reprogramming of Stromal Pdgfra-expressing cells during WNT-Mediated Transformation of the Intestinal Epithelium.Pellon-Cardenas O, Rout P, Hassan S, Fokas E, Ping H, Patel I, Patel J, Plotsker O, Wu A, Kumar R, Akther M, Logerfo A, Wu S, Wagner DE, Boffelli D, Walton KD, Manieri E, Tong K, Spence JR, Bessman NJ, Shivdasani RA, Verzi MP2025 Jan 25 39896606
PMID: 39701210

Title: Deriving Human Intestinal Organoids with Functional Tissue-Resident Macrophages All From Pluripotent Stem Cells.

Authors: Tominaga K, Kechele DO, Sanchez JG, Vales S, Jurickova I, Roman L, Asai A, Enriquez JR, McCauley HA, Kishimoto K, Iwasawa K, Singh A, Horio Y, Múnera JO, Takebe T, Zorn AM, Helmrath MA, Denson LA, Wells JM

Journal: Cell Mol Gastroenterol Hepatol

Publication Date: 2025

DOI: https://doi.org/10.1016/j.jcmgh.2024.101444

MeSH Terms: Humans, Organoids, Macrophages, Animals, Pluripotent Stem Cells, Cell Differentiation, Mice, Coculture Techniques, Intestines, Phagocytosis, Gene Expression Profiling, Intestinal Mucosa



No data and code information found in the publication.
 Deriving Human Intestinal Organoids with Functional Tissue-Resident Macrophages All From Pluripotent Stem Cells.Tominaga K, Kechele DO, Sanchez JG, Vales S, Jurickova I, Roman L, Asai A, Enriquez JR, McCauley HA, Kishimoto K, Iwasawa K, Singh A, Horio Y, Múnera JO, Takebe T, Zorn AM, Helmrath MA, Denson LA, Wells JM2025 39701210
PMID: 39007612

Title: Using Human Intestinal Organoids to Understand the Small Intestine Epithelium at the Single Cell Transcriptional Level.

Authors: Bomidi C, Zeng XL, Poplaski V, Coarfa C, Estes MK, Blutt SE

Journal: J Vis Exp

Publication Date: 2024 Jun 28

DOI: https://doi.org/10.3791/66749

MeSH Terms: Humans, Organoids, Intestine, Small, Single-Cell Analysis, Intestinal Mucosa, Gene Expression Profiling, Transcriptome



No data and code information found in the publication.
 Using Human Intestinal Organoids to Understand the Small Intestine Epithelium at the Single Cell Transcriptional Level.Bomidi C, Zeng XL, Poplaski V, Coarfa C, Estes MK, Blutt SE2024 Jun 28 39007612
PMID: 39036707

Title: Mechanical stimulation promotes human intestinal villus morphogenesis in vivo.

Authors: Poling HM, Brown N, Wells JM, Barrile R, Helmrath MA, Mahe MM

Journal: Biophys Rev (Melville)

Publication Date: 2024 Sep

DOI: https://doi.org/10.1063/5.0221220

MeSH Terms: No Mesh Terms available



No data and code information found in the publication.
 Mechanical stimulation promotes human intestinal villus morphogenesis in vivo.Poling HM, Brown N, Wells JM, Barrile R, Helmrath MA, Mahe MM2024 Sep 39036707
PMID: 39270642

Title: Human pluripotent stem cell-derived organoids repair damaged bowel in vivo.

Authors: Poling HM, Sundaram N, Fisher GW, Singh A, Shiley JR, Nattamai K, Govindarajah V, Cortez AR, Krutko MO, Ménoret S, Anegon I, Kasendra M, Wells JM, Mayhew CN, Takebe T, Mahe MM, Helmrath MA

Journal: Cell Stem Cell

Publication Date: 2024 Oct 3

DOI: https://doi.org/10.1016/j.stem.2024.08.009

MeSH Terms: Organoids, Humans, Pluripotent Stem Cells, Animals, Intestine, Small, Mice, Regeneration, Rats



REAGENT or RESOURCESOURCEIDENTIFIER
Antibodies
Ki-67 Monoclonal Antibody (SolA15), eBioscience™ThermoFisherCat#14-5698-82; RRID: AB_10854564
FABP1 (D2A3X) XP® Rabbit mAbCell Signaling TechnologyCat#13368S; RRID: AB_2798192
Anti-Lysozyme antibody AbcamCat#ab108508; RRID: AB_10861277
Anti-MUC2 antibody AbcamCat#ab272692; RRID: AB_2888616
Anti-Chromogranin A antibodyAbcamCat#ab45179; RRID: AB_726879
Anti-DCAMKL1 antibodyAbcamCat#ab37994; RRID: AB_873538
Active/Pro-Caspase 3 Recombinant Rabbit Monoclonal Antibody (ARC0133)ThermoFisherCat#MA5-35333; RRID: AB_2849235
GFP AntibodyRocklandCat#600-101-215; RRID: AB_218182
RFP Antibody Pre-adsorbedRocklandCat#600-401-379; RRID: AB_2209751
Olfm4 (D6Y5A) XP® Rabbit mAbCell Signaling TechnologyCat#39141S; RRID: AB_2650511
a-Tubulin AntibodyCell Signaling TechnologyCat#2144S; RRID: AB_2210548
RNA pol II antibody (mAb)ACTIVE MOTIFCat#39497; RRID: AB_2732926
Histone H3K4me3 antibody (pAb)ACTIVE MOTIFCat#39497; RRID: AB_2615077
H3K27me3 AntibodyEpiCypherCat# 13-0055; RRID: AB_3665059
Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 546ThermoFisherCat#A10040; RRID: AB_2534016
Donkey anti-Goat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488ThermoFisherCat#A11055; RRID: AB_2534102
Donkey anti-Rat IgG (H+L) Cross-Adsorbed Secondary Antibody, DyLight™ 550ThermoFisherCat#SA5-10027; RRID: AB_2556607
Chemicals, peptides, and recombinant proteins
Recombinant Murine NogginPeproTechCat#250-38
Recombinant Murine EGFPeproTechCat# 315-09
Recombinant Mouse R-Spondin 1 (CHO-expressed) ProteinR&D SystemsCat#7150-RS-250/CF
N-Acetyl-L-cysteineMilliporeSigmaCat#A9165
Advanced DMEM/F-12ThermoFisherCat#12634010
N-2 Supplement (100X)ThermoFisherCat#17502048
B-27™ Supplement (50X), serum freeThermoFisherCat#17504044
HEPES (1 M)ThermoFisherCat#15630080
GlutaMAX™ SupplementThermoFisherCat#35050061
DMEM, high glucoseThermoFisherCat#11965092
TrypLE™ Express Enzyme (1X), no phenol redThermoFisherCat#12604021
Corning® Matrigel® Matrix for Organoid Culture, Phenol Red-free, LDEV-freeCorningCat#356231
4-Hydroxytamoxifen Ready Made SolutionMilliporeSigmaCat#SML1666
Recombinant Mouse Wnt-3a ProteinR&D SystemsCat#1324-WN-010/CF
Recombinant Human/Mouse Wnt-5a ProteinR&D SystemsCat#645-WN-010/CF
Y-27632 dihydrochlorideMilliporeSigmaCat#Y0503
Opal 520 Reagent PackAKOYACat#FP1487001KT
Opal 570 Reagent PackAKOYACat#FP1488001KT
Opal 690 Reagent PackAKOYACat#FP1497001KT
HBSS, no calcium, no magnesiumThermoFisherCat#14170120
Intercept® (TBS) Blocking Buffer and Diluent KitLI-CORCat#927-66003
cOmplete™, EDTA-free Protease Inhibitor CocktailMilliporeSigmaCat#11873580001
TWEEN® 20MilliporeSigmaCat#P9416
4–15% Mini-PROTEAN® TGX Stain-Free™ Protein GelsBioradCat#4568084
Immun-Blot® Low Fluorescence PVDF MembraneBioradCat#1620264
Gentle Cell Dissociation ReagentStem Cell TechnologyCat#100-0485
Fluoro-Gel Mounting Medium with Tris BufferElectron Microscopy SciencesCat#17985-10
DAPIMilliporeSigmaCat#D9542
ProLong™ Gold Antifade Mountant with DAPIThermoFisherCat#P36935
Universal blocking buffer (10X)BioGenexCat#HK085-5K
Critical commercial assays
RNAscope™ Multiplex Fluorescent Detection Kit v2ACDCat#323110
Dead Cell Removal KitMiltenyi BiotecCat#130-090-101
CUTANA™ CUT&Tag KitEpiCypherCat#14-1102
RNeasy Mini KitQIAGENCat#74104
CellTiter-Glo® 3D Cell Viability AssayPromegaCat#G9681
High-Capacity cDNA Reverse Transcription KitThermoFisherCat#4368814
Fast SYBR™ Green Master MixThermoFisherCat#4385612
Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle10X GenomicsCat#PN-1000283
Chromium Next GEM Single Cell 3 GEM, Library & Gel Bead Kit v3.110X GenomicsCat#PN-1000121
Deposited data
Raw and analyzed sequencing dataThis paperGEO: GSE221421
Original western blot imagesThis paperMendeley data: https://data.mendeley.com/datasets/27n3yh5wbs/1
Experimental models: Cell lines
293TATCCCat# CRL-3216
Experimental models: Organisms/strains
Mouse: C57BL/6JThe Jackson Laboratory000664
Mouse: Lgr5EGFP-IRES-Cre-ER (B6.129P2-Lgr5tm1(cre/ERT2)Cle/J)The Jackson Laboratory008875
Mouse: Fzd5van Es et al.N/A
Mouse: Villin-Cre-ERel Marjou et al. N/A
Mouse: Krt19-Cre-ERMeans et al.N/A
Mouse: ROSA (B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J)The Jackson Laboratory007914
Mouse: mT/mG (Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J)The Jackson Laboratory007576
Mouse: Fzd5-IRES-Dre-ER-P2A-tdTomatoThis paperN/A
Oligonucleotides
Quantitative real-time PCR primers (See Table S1)Integrated DNA TechnologiesN/A
TRC Lentiviral shRNA targeting Fzd7(mouse)Horizon discoveryCat#RMM4534-EG14369
Primer for genotyping Fzd5-reporter mouse: WT-F: 5’- CATCACGTCGGGAGTCTGGATCTG -3’This paperN/A
WT-R: 5’- CCAACAGTAACCTCATTACAATGCC -3’This paperN/A
Mut-R 5’- CCTAGGAATGCTCGTCAAGAAGACAG -3’This paperN/A
RNAscope™ Probe- Mm-Fzd5ACDCat#404911
RNAscope™ Probe- Mm-Ascl2-C2ACDCat#412211-C2
RNAscope™ Probe- Mm-Krt19-C2ACDCat#402941-C2
RNAscope™ Probe- Mm-LGR5-C3ACDCat#312171-C3
Software and algorithms
FlowJohttps://www.flowjo.com/N/A
Fijihttps://fiji.sc/N/A
Cellranger (v4.0)https://www.10xgenomics.com/N/A
GraphPad Prism 9https://www.graphpad.com/N/A
Seurat (version 4.1.1)Hao et al.N/A
Signac (version 1.13)Stuart et al.N/A
Harmony (version 0.1.0)Korsunsky et al.N/A
scVelo(version 0.2.5)Bergen et al.N/A
Other
ODYSSEY® DLxLI-CORN/A
BD FACSMelody™ Cell SorterBDN/A
BD Influx™ Cell SorterBDN/A
Singulator 100S2 GenomicsN/A

 Human pluripotent stem cell-derived organoids repair damaged bowel in vivo.Poling HM, Sundaram N, Fisher GW, Singh A, Shiley JR, Nattamai K, Govindarajah V, Cortez AR, Krutko MO, Ménoret S, Anegon I, Kasendra M, Wells JM, Mayhew CN, Takebe T, Mahe MM, Helmrath MA2024 Oct 3 39270642
PMID: 39048815

Title: A human autoimmune organoid model reveals IL-7 function in coeliac disease.

Authors: Santos AJM, van Unen V, Lin Z, Chirieleison SM, Ha N, Batish A, Chan JE, Cedano J, Zhang ET, Mu Q, Guh-Siesel A, Tomaske M, Colburg D, Varma S, Choi SS, Christophersen A, Baghdasaryan A, Yost KE, Karlsson K, Ha A, Li J, Dai H, Sellers ZM, Chang HY, Dunn JCY, Zhang BM, Mellins ED, Sollid LM, Fernandez-Becker NQ, Davis MM, Kuo CJ

Journal: Nature

Publication Date: 2024 Aug

DOI: https://doi.org/10.1038/s41586-024-07716-2

MeSH Terms: Humans, Autoantibodies, Autoimmunity, B-Lymphocytes, Biopsy, Celiac Disease, Duodenum, Epitopes, Glutens, GTP-Binding Proteins, HLA-DQ Antigens, Interleukin-7, Intestinal Mucosa, Killer Cells, Natural, Models, Biological, Myeloid Cells, Organoids, Protein Glutamine gamma Glutamyltransferase 2, Receptors, Antigen, B-Cell, Receptors, Antigen, T-Cell, T-Lymphocytes



No data and code information found in the publication.
 A human autoimmune organoid model reveals IL-7 function in coeliac disease.Santos AJM, van Unen V, Lin Z, Chirieleison SM, Ha N, Batish A, Chan JE, Cedano J, Zhang ET, Mu Q, Guh-Siesel A, Tomaske M, Colburg D, Varma S, Choi SS, Christophersen A, Baghdasaryan A, Yost KE, Karlsson K, Ha A, Li J, Dai H, Sellers ZM, Chang HY, Dunn JCY, Zhang BM, Mellins ED, Sollid LM, Fernandez-Becker NQ, Davis MM, Kuo CJ2024 Aug 39048815
PMID: 39257805

Title: Regulatory network analysis of Dclk1 gene expression reveals a tuft cell-ILC2 axis that inhibits pancreatic tumor progression.

Authors: Valenti G, Laise P, Takahashi R, Wu F, Ruan T, Vasciaveo A, Jiang Z, Sunagawa M, Middelhoff M, Nienhüser H, Fu N, Malagola E, Hayakawa Y, Iuga AC, Califano A, Wang TC

Journal: bioRxiv

Publication Date: 2024 Oct 12

DOI: pii: 2024.08.30.610508. doi: 10.1101/2024.08.30.610508

MeSH Terms: No Mesh Terms available



No data and code information found in the publication.
 Regulatory network analysis of Dclk1 gene expression reveals a tuft cell-ILC2 axis that inhibits pancreatic tumor progression.Valenti G, Laise P, Takahashi R, Wu F, Ruan T, Vasciaveo A, Jiang Z, Sunagawa M, Middelhoff M, Nienhüser H, Fu N, Malagola E, Hayakawa Y, Iuga AC, Califano A, Wang TC2024 Oct 12 39257805
PMID: 39579769

Title: Frizzled5 controls murine intestinal epithelial cell plasticity through organization of chromatin accessibility.

Authors: Deng L, He XC, Chen S, Zhang N, Deng F, Scott A, He Y, Tsuchiya D, Smith SE, Epp M, Malloy S, Liu F, Hembree M, Mu Q, Haug JS, Malagola E, Hassan H, Petentler K, Egidy R, Maddera L, Russell J, Wang Y, Li H, Zhao C, Perera A, Wang TC, Kuo CJ, Li L

Journal: Dev Cell

Publication Date: 2024 Nov 15

DOI: https://doi.org/10.1016/j.devcel.2024.10.021

MeSH Terms: No Mesh Terms available



REAGENT or RESOURCESOURCEIDENTIFIER
Antibodies
Ki-67 Monoclonal Antibody (SolA15), eBioscience™ThermoFisherCat#14-5698-82; RRID: AB_10854564
FABP1 (D2A3X) XP® Rabbit mAbCell Signaling TechnologyCat#13368S; RRID: AB_2798192
Anti-Lysozyme antibody [EPR2994(2)]AbcamCat#ab108508; RRID: AB_10861277
Anti-MUC2 antibody [EPR23479-47]AbcamCat#ab272692; RRID: AB_2888616
Anti-Chromogranin A antibodyAbcamCat#ab45179; RRID: AB_726879
Anti-DCAMKL1 antibodyAbcamCat#ab37994; RRID: AB_873538
Active/Pro-Caspase 3 Recombinant Rabbit Monoclonal Antibody (ARC0133)ThermoFisherCat#MA5-35333; RRID: AB_2849235
GFP AntibodyRocklandCat#600-101-215; RRID: AB_218182
RFP Antibody Pre-adsorbedRocklandCat#600-401-379; RRID: AB_2209751
Olfm4 (D6Y5A) XP® Rabbit mAbCell Signaling TechnologyCat#39141S; RRID: AB_2650511
a-Tubulin AntibodyCell Signaling TechnologyCat#2144S; RRID: AB_2210548
RNA pol II antibody (mAb)ACTIVE MOTIFCat#39497; RRID: AB_2732926
Histone H3K4me3 antibody (pAb)ACTIVE MOTIFCat#39497; RRID: AB_2615077
H3K27me3 AntibodyEpiCypherCat# 13-0055; RRID: AB_3665059
Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 546ThermoFisherCat#A10040; RRID: AB_2534016
Donkey anti-Goat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488ThermoFisherCat#A11055; RRID: AB_2534102
Donkey anti-Rat IgG (H+L) Cross-Adsorbed Secondary Antibody, DyLight™ 550ThermoFisherCat#SA5-10027; RRID: AB_2556607
Chemicals, peptides, and recombinant proteins
Recombinant Murine NogginPeproTechCat#250-38
Recombinant Murine EGFPeproTechCat# 315-09
Recombinant Mouse R-Spondin 1 (CHO-expressed) ProteinR&D SystemsCat#7150-RS-250/CF
N-Acetyl-L-cysteineMilliporeSigmaCat#A9165
Advanced DMEM/F-12ThermoFisherCat#12634010
N-2 Supplement (100X)ThermoFisherCat#17502048
B-27™ Supplement (50X), serum freeThermoFisherCat#17504044
HEPES (1 M)ThermoFisherCat#15630080
GlutaMAX™ SupplementThermoFisherCat#35050061
DMEM, high glucoseThermoFisherCat#11965092
TrypLE™ Express Enzyme (1X), no phenol redThermoFisherCat#12604021
Corning® Matrigel® Matrix for Organoid Culture, Phenol Red-free, LDEV-freeCorningCat#356231
4-Hydroxytamoxifen Ready Made SolutionMilliporeSigmaCat#SML1666
Recombinant Mouse Wnt-3a ProteinR&D SystemsCat#1324-WN-010/CF
Recombinant Human/Mouse Wnt-5a ProteinR&D SystemsCat#645-WN-010/CF
Y-27632 dihydrochlorideMilliporeSigmaCat#Y0503
Opal 520 Reagent PackAKOYACat#FP1487001KT
Opal 570 Reagent PackAKOYACat#FP1488001KT
Opal 690 Reagent PackAKOYACat#FP1497001KT
HBSS, no calcium, no magnesiumThermoFisherCat#14170120
Intercept® (TBS) Blocking Buffer and Diluent KitLI-CORCat#927-66003
cOmplete™, EDTA-free Protease Inhibitor CocktailMilliporeSigmaCat#11873580001
TWEEN® 20MilliporeSigmaCat#P9416
4–15% Mini-PROTEAN® TGX Stain-Free™ Protein GelsBioradCat#4568084
Immun-Blot® Low Fluorescence PVDF MembraneBioradCat#1620264
Gentle Cell Dissociation ReagentStem Cell TechnologyCat#100-0485
Fluoro-Gel Mounting Medium with Tris BufferElectron Microscopy SciencesCat#17985-10
DAPIMilliporeSigmaCat#D9542
ProLong™ Gold Antifade Mountant with DAPIThermoFisherCat#P36935
Universal blocking buffer (10X)BioGenexCat#HK085-5K
Critical commercial assays
RNAscope™ Multiplex Fluorescent Detection Kit v2ACDCat#323110
Dead Cell Removal KitMiltenyi BiotecCat#130-090-101
CUTANA™ CUT&Tag KitEpiCypherCat#14-1102
RNeasy Mini KitQIAGENCat#74104
CellTiter-Glo® 3D Cell Viability AssayPromegaCat#G9681
High-Capacity cDNA Reverse Transcription KitThermoFisherCat#4368814
Fast SYBR™ Green Master MixThermoFisherCat#4385612
Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle10X GenomicsCat#PN-1000283
Chromium Next GEM Single Cell 3' GEM, Library & Gel Bead Kit v3.110X GenomicsCat#PN-1000121
Deposited data
Raw and analyzed sequencing dataThis paperGEO: GSE221421
Original western blot imagesThis paperMendeley data: https://data.mendeley.com/datasets/27n3yh5wbs/1
Experimental models: Cell lines
293TATCCCat# CRL-3216
Experimental models: Organisms/strains
Mouse: C57BL/6JThe Jackson Laboratory000664
Mouse: Lgr5EGFP-IRES-Cre-ERT2 (B6.129P2-Lgr5tm1(cre/ERT2)Cle/J)The Jackson Laboratory008875
Mouse: Fzd5flox/floxvan Es et al.26N/A
Mouse: Villin-Cre-ERT2el Marjou et al. 39N/A
Mouse: Krt19-Cre-ERT2Means et al.40N/A
Mouse: ROSAtdTomato (B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J)The Jackson Laboratory007914
Mouse: mT/mG (Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J)The Jackson Laboratory007576
Mouse: Fzd5-IRES-Dre-ERT2-P2A-tdTomatoThis paperN/A
Oligonucleotides
Quantitative real-time PCR primers (See Table S1)Integrated DNA TechnologiesN/A
TRC Lentiviral shRNA targeting Fzd7(mouse)Horizon discoveryCat#RMM4534-EG14369
Primer for genotyping Fzd5-reporter mouse: WT-F: 5’- CATCACGTCGGGAGTCTGGATCTG -3’This paperN/A
WT-R: 5’- CCAACAGTAACCTCATTACAATGCC -3’This paperN/A
Mut-R 5’- CCTAGGAATGCTCGTCAAGAAGACAG -3’This paperN/A
RNAscope™ Probe- Mm-Fzd5ACDCat#404911
RNAscope™ Probe- Mm-Ascl2-C2ACDCat#412211-C2
RNAscope™ Probe- Mm-Krt19-C2ACDCat#402941-C2
RNAscope™ Probe- Mm-LGR5-C3ACDCat#312171-C3
Software and algorithms
FlowJohttps://www.flowjo.com/N/A
Fijihttps://fiji.sc/N/A
Cellranger (v4.0)https://www.10xgenomics.com/N/A
GraphPad Prism 9https://www.graphpad.com/N/A
Seurat (version 4.1.1)Hao et al.41N/A
Signac (version 1.13)Stuart et al.42N/A
Harmony (version 0.1.0)Korsunsky et al.48N/A
scVelo(version 0.2.5)Bergen et al.30N/A
Other
ODYSSEY® DLxLI-CORN/A
BD FACSMelody™ Cell SorterBDN/A
BD Influx™ Cell SorterBDN/A
Singulator 100S2 GenomicsN/A

 Frizzled5 controls murine intestinal epithelial cell plasticity through organization of chromatin accessibility.Deng L, He XC, Chen S, Zhang N, Deng F, Scott A, He Y, Tsuchiya D, Smith SE, Epp M, Malloy S, Liu F, Hembree M, Mu Q, Haug JS, Malagola E, Hassan H, Petentler K, Egidy R, Maddera L, Russell J, Wang Y, Li H, Zhao C, Perera A, Wang TC, Kuo CJ, Li L2024 Nov 15 39579769
PMID: 39579768

Title: FZD5 controls intestinal crypt homeostasis and colonic Wnt surrogate agonist response.

Authors: Mu Q, Ha A, Santos AJM, Lo YH, van Unen V, Miao Y, Tomaske M, Guzman VK, Alwahabi S, Yuan JJ, Deng L, Li L, Garcia KC, Kuo CJ

Journal: Dev Cell

Publication Date: 2024 Nov 19

DOI: https://doi.org/10.1016/j.devcel.2024.10.022

MeSH Terms: No Mesh Terms available



No data and code information found in the publication.
 FZD5 controls intestinal crypt homeostasis and colonic Wnt surrogate agonist response.Mu Q, Ha A, Santos AJM, Lo YH, van Unen V, Miao Y, Tomaske M, Guzman VK, Alwahabi S, Yuan JJ, Deng L, Li L, Garcia KC, Kuo CJ2024 Nov 19 39579768
PMID: 38848677

Title: Time-resolved fate mapping identifies the intestinal upper crypt zone as an origin of Lgr5+ crypt base columnar cells.

Authors: Capdevila C, Miller J, Cheng L, Kornberg A, George JJ, Lee H, Botella T, Moon CS, Murray JW, Lam S, Calderon RI, Malagola E, Whelan G, Lin CS, Han A, Wang TC, Sims PA, Yan KS

Journal: Cell

Publication Date: 2024 Jun 6

DOI: https://doi.org/10.1016/j.cell.2024.05.001

MeSH Terms: Receptors, G-Protein-Coupled, Animals, Mice, Intestinal Mucosa, Stem Cells, Cell Lineage, Regeneration, Cell Proliferation, Epithelial Cells, Mice, Inbred C57BL, Homeostasis



REAGENT or RESOURCESOURCE IDENTIFIER
Antibodies
Rabbit polyclonal anti-RFP pre-adsorbed RocklandCat#600-401-379; RRID: AB_2209751
Anti-mTagBFP2 single domain antibodyNanoTag BiotechnologiesCat#N0502-AF647-L
Chicken polyclonal anti-GFPAveslabs Cat#GFP-1020; RRID: AB_2307313
Rabbit monoclonal anti-Ki67 Clone D3B5Cell Signaling TechnologyCat#9129; RRID: AB_2687446
Rat monoclonal anti-ki67 Clone SolA15InvitrogenCat#14-5698-82; RRID: AB_1085456
Goat polyclonal anti-CHGASanta Cruz BiotechnologyCat#sc-1488; RRID: AB_2276319
Rabbit polyclonal anti-lysozyme1Agilent DakoCat#A0099; RRID: AB_2341230
Mouse monoclonal anti-lysozyme1 Clone E-5Santa Cruz BiotechnologyCat#sc-27958; RRID: AB_2138790
Rabbit polyclonal anti-FABP1Novus BiologicalsCat#NBP1-87695; RRID: AB_1102215
Mouse monoclonal anti-FLAG Clone M2Sigma-AldrichCat#F1804; RRID: AB_262044
Rabbit polyclonal anti-beta-ActinCell Signaling TechnologyCat#4967; RRID: AB_330288
Mouse monoclonal anti-MUC2Novus BiologicalsCat#NB120-11197; RRID: AB_791261
Rabbit polyclonal anti-Mucin2Santa Cruz BiotechnologyCat#sc-15334; RRID: AB_2146667
Alexa Fluor® 488 Mouse anti-E-CadherinBD BiosciencesCat#560061; RRID: AB_1645347
BD Horizon™ BV421 Mouse Anti-E-CadherinBD BiosciencesCat#564186
Goat polyclonal anti-ACE-2R&D SystemsCat#AF933; RRID: AB_355722
Goat polyclonal antibody to tdTomato red fluorescent proteinbiorbytCat#orb182397
Rabbit monoclonal anti-Cleaved Caspase-3 Asp175 5A1ECell Signaling TechnologyCat#9664; RRID: AB_2070042
Rabbit monoclonal anti-Olfm4 Clone D6Y5ACell Signaling TechnologyCat#39141; RRID: AB_2650511
Donkey anti-Rabbit IgG H+L Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 568InvitrogenCat#A10042; RRID: AB_2534017
Donkey anti-Goat IgG H+L Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 647InvitrogenCat#A21447; RRID: AB_2535864
Donkey anti-Mouse IgG H+L Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488InvitrogenCat#A21202; RRID: AB_141607
Donkey anti-Rat IgG H+L Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 594InvitrogenCat#A21209
Alexa Fluor® 647 AffiniPure Fab Fragment Donkey Anti-Rat IgG H+LJackson ImmunoResearch LabsCat#712-606-150; RRID: AB_2340695
Alexa Fluor® 488 AffiniPure Fab Fragment Donkey Anti-Chicken IgY IgG H+LJackson ImmunoResearch LabsCat#703-546-155; RRID: AB_2340376
Donkey anti-Mouse IgG IRDye® 800CWLI-COR BiosciencesCat#926-32212
Donkey anti-Rabbit IgG IRDye® 680CWLI-COR BiosciencesCat#926-68073
Bacterial and virus strains
NEB 10-beta Competent E. coli High EfficiencyNew England BiolabsCat#C3019H
FLAG-Fgfbp1-expressing lentivirusThis paperN/A
Chemicals, peptides, and recombinant proteins
TamoxifenSigma-AldrichCat#T5648; CAS: 10540-29-1
Diphtheria Toxin from Corynebacterium DiphtheriaeSigma-AldrichCat#D0564-1MG
Advanced DMEM/F-12 ADMEM/F-12GibcoCat#12634-010
Advanced DMEM ADMEMGibcoCat#12491-015
IMDMGibcoCat#12440-053
DMEMGibcoCat#11995-065
PuromycinSigma-AldrichCat#P8833; CAS: 58-58-2
MatrigelCorningCat#356231
N-2 Supplement 100XGibcoCat#17502-048
B-27 Supplement 50XGibcoCat#17504-044
EGFPeproTechCat#AF-100-15
CHIR99021Sigma-AldrichCat#SML1046; CAS:
252917-06-9
Collagenase/DispaseSigma-AldrichCat#10269638001
Rho Kinase inhibitorTocrisCat#1254
Lipofectamine 3000 Transfection ReagentInvitrogenCat#L3000001
HistoDenz1.46Sigma-AldrichCat#D2158; CAS: 66108-95-0
Phytagel/HD1.46Sigma-AldrichCat#P8169; CAS: 71010-52-1
Antigen Unmasking Solution, Citric Acid BasedVector LaboratoriesCat#H-3300
Vectashield Plus Antifade Mounting MediumVector LaboratoriesCat#H-1900
Ready Probes Mouse on Mouse IgG Blocking SolutionInvitrogenCat#R37621
Fetal Bovine SerumR&D SystemsCat#S11150
Normal Donkey SerumJackson ImmunoResearch LabsCat#017-000-121
DAPIRocheCat#10236276001
SYTOX™ Blue Dead Cell StainInvitrogenCat#S34857
10% Neutral Buffered FormalinVWRCat#89370-094
Paraformaldehyde PFAElectron Microscopy SciencesCat#15714-S
Tissue-Tek O.C.T. CompoundSakura FinetekCat#4583
PrimocinInvivoGenCat#ant-pm-05
Penicillin-Streptomycin-Glutamine PSQ 100xGibcoCat#10378-016
Penicillin-StreptomycinGibcoCat#15140-122
100X Non-Essential Amino AcidsMP Biomedicals, LLCCat#1681049
PBS, 1XCorningCat#21-040-CM
Tween 20Fisher ScientificCat#BP337-500; CAS: 9005-64-5
Triton X-100SigmaCat#T8787; CAS: 9002-93-1
HEPES 1MGibcoCat#15630-080
UltraPure 0.5 M EDTA, pH 8.0InvitrogenCat#15575-038
GlutaMAX-I 100XGibcoCat#35050-061
TrypLE ExpressGibcoCat#12604-013
10x Tris/Glycine/SDS BufferBio-RadCat#1610732
10x Tris/Glycine BufferBio-RadCat#1610734
PageRuler Prestained Protein LadderThermo ScientificCat#26616
RIPA Lysis and Extraction BufferThermo ScientificCat#89900
cOmplete™ Protease Inhibitor CocktailMillipore SigmaCat#4693116001
Sodium Dodecyl SulfateSigma-AldrichCat#71725-50G; CAS: 151-21-3
Restriction endonucleases variousNew England BiolabsN/A
Critical commercial assays
RNeasy Mini KitQiagenCat#74106
Phusion ® High-Fidelity DNA PolymeraseNew England BiolabsCat#M0530L
ZymoPURE Plasmid Miniprep KitZymo ResearchCat#D4211
ZymoPURE II Plasmid Midiprep KitZymo ResearchCat#D4201
Zymoclean Gel DNA Recovery KitZymo ResearchCat#D4002
DNA Clean & Concentrator-5Zymo ResearchCat#4004
NEBuilder ® HiFi DNA Assembly Master MixNew England BiolabsCat#E2621L
T4 DNA LigaseNew England BiolabsCat#M0202S
Anti-Flag ® M2 Magnetic BeadsMillipore SigmaCat#M8823-1ML
RNAScope ® Multiplex Fluorescent Reagent Kit v2Advanced Cell DiagnosticsCat#323100
RNA-Protein Co-Detection Ancillary KitAdvanced Cell DiagnosticsCat#323180
RNAScope ® 4-Plex Ancillary Kit for Multiplex Fluorescent Reagent Kit v2Advanced Cell DiagnosticsCat#323120
Deposited data
Single-Cell RNA-seq of intestinal epithelial cells upon Wnt/Rspo pharmacological modulationYan et al.31GEO accession: GSE92865
Single-Cell RNA-seq of intestinal epithelial cells unperturbedHaber et al.34GEO accession: GSE92332
Single-Cell RNA-seq of intestinal epithelial cells unperturbed, enriched for secretory cell typesBöttcher et al.37GEO accession: GSE152325
Experimental models: Cell lines
HEK293T 293TATCCCat#CRL-3216; RRID: CVCL_0063
Wnt3A/RSPO1/Noggin expressing cells L-WRNATCCCat#CRL-3276; RRID: DA06
KV1 129S6_C57BL/6N HybridDr. Chyuan-Sheng Lin, Columbia UniversityN/A
Experimental models: Organisms/strains
Mouse: Lgr5-eGFP-IRES-CreERT2: B6.129P2-Lgr5tm1cre/ERT2Cle/JThe Jackson LaboratoryJAX: 008875; RRID: IMSR_JAX:008875
Mouse: Villin-CreERT2: B6.Cg-TgVil1-cre/ERT223Syr/JThe Jackson LaboratoryJAX: 020282; RRID: IMSR_JAX:020282
Mouse: Lgr5-DTR-GFPDr. Frederic de Sauvage, GenentechN/A
Mouse: Fgfbp1-CreERT2This paperN/A
Mouse: Fgfbp1-TimeRThis paperN/A
Mouse: Rosa26-CreERT2: GtROSA26Sortm1cre/ERT2Ty/JThe Jackson LaboratoryJAX: 008463; RRID: IMSR_JAX:008463
Mouse: Rosa26-Confetti: B6.129P2-GtROSA26Sortm1CAG-Brainbow2.1Cle/JThe Jackson LaboratoryJAX: 017492; RRID: IMSR_JAX:017492
Mouse: Rosa26-tdTomato: B6.Cg-GtROSA26Sortm14CAG-tdTomatoHze/JThe Jackson LaboratoryJAX: 007914; RRID: IMSR_JAX:005703
Mouse: Actin-Flpe: TgACTFLPe9205DymThe Jackson LaboratoryJAX: 005703; RRID: IMSR_JAX:005703
Oligonucleotides
RNAscope ® Mm Lgr5 probeAdvanced Cell DiagnosticsCat#312171
RNAscope ® Mm Fgfbp1 probeAdvanced Cell DiagnosticsCat#508831-C4
RNAscope ® Mm Dmbt1 probeAdvanced Cell DiagnosticsCat#418561-C2
Recombinant DNA
pMCS-DT.ADr. Kosuke Yusa, Osaka University, JapanN/A
pCS2+RZPDN/A
pLenti CMV GFP Puro 658-5Campeau et al.73Addgene: Plasmid #17448
pMD2.GDidier Trono labAddgene: Plasmid #12259
psPAX2Didier Trono labAddgene: Plasmid #12260
FLAG-Fgfbp1 lentiviral expression plasmidThis paperN/A
DsRedE2-PEST expression plasmidThis paperN/A
1xUbVR-DsRedE2-PEST expression plasmidThis paperN/A
Software and algorithms
FlowJo V10.8.1BD Bioscienceshttps://www.flowjo.com/
Leica Application Suite X LAS XLeica Microsystemshttps://www.leica-microsystems.com/products/microscope-software/p/leica-las-x-ls/
Zen blue 3.5 ZEISS ZEN liteCarl Zeiss Microscopyhttps://www.zeiss.com/microscopy/en/products/software/zeiss-zen-lite.html
Fiji/ImageJ 2.14.0; Java1.8.0_322Wayne Rasband and Contributors, National Insitutes of Health, USAhttps://imagej.org
R v4.0.3R Core Teamhttps://www.r-project.org/
Seurat v4.2.0Satija Labhttps://satijalab.org/seurat/
Nebulosa v1.0.2Alquicira-Hernandez and Powell74https://github.com/powellgenomicslab/Nebulosa
ggplot2 v3.3.6N/Ahttps://github.com/tidyverse/ggplot2
scVelo v0.2.2Bergen et al.35https://scvelo.readthedocs.io/
velocyto v.0.17Kharchenko Labhttps://velocyto.org/velocyto.py/
Python v3.7.7Python Software Foundationhttps://python.org/
Cell Ranger v5.0.010X GenomicsN/A
Prism v8.0.1GraphPad Softwarehttps://www.graphpad.com/scientific-software/prism/
Other
Odyssey CLx ImagerLI-COR BiosciencesN/A
Zeiss Confocal Microscope LSM 710Carl Zeiss MicroscopyN/A
Leica DMi8 Stellaris confocal microscopeLeica MicrosystemsN/A
Leica DMi8 Widefield microscopeLeica MicrosystemsN/A
Leica CM3050 S CryostatLeica BiosystemsN/A
Microm HM 325 MicrotomeThermo ScientificN/A
Superfrost Plus Microscope Slides White TabFisher ScientificCat#1255015
Microscope Cover GlassFisher ScientificCat#12544D
Novocyte Quanteon flow cytometerAgilentN/A
BD FACSAria II Cell SorterBD BiosystemsN/A
Amicon® Ultra-15 Centrifugal Filter UnitMilliporeCat#UFC910008

 Time-resolved fate mapping identifies the intestinal upper crypt zone as an origin of Lgr5+ crypt base columnar cells.Capdevila C, Miller J, Cheng L, Kornberg A, George JJ, Lee H, Botella T, Moon CS, Murray JW, Lam S, Calderon RI, Malagola E, Whelan G, Lin CS, Han A, Wang TC, Sims PA, Yan KS2024 Jun 6 38848677
PMID: 38781967

Title: Patterning and folding of intestinal villi by active mesenchymal dewetting.

Authors: Huycke TR, Häkkinen TJ, Miyazaki H, Srivastava V, Barruet E, McGinnis CS, Kalantari A, Cornwall-Scoones J, Vaka D, Zhu Q, Jo H, Oria R, Weaver VM, DeGrado WF, Thomson M, Garikipati K, Boffelli D, Klein OD, Gartner ZJ

Journal: Cell

Publication Date: 2024 Jun 6

DOI: https://doi.org/10.1016/j.cell.2024.04.039

MeSH Terms: Animals, Mice, Intestinal Mucosa, Extracellular Matrix, Myosin Type II, Mesoderm, Mesenchymal Stem Cells, Receptor, Platelet-Derived Growth Factor alpha, Morphogenesis, Matrix Metalloproteinases



REAGENT or RESOURCESOURCEIDENTIFIER
Antibodies
Rabbit polyclonal anti-RFP pre-adsorbedRocklandCat#600-401-379; RRID: AB_2209751
Anti-mTagBFP2 single domain antibodyNanoTag BiotechnologiesCat#N0502-AF647-L
Chicken polyclonal anti-GFPAveslabsCat#GFP-1020; RRID: AB_2307313
Rabbit monoclonal anti-Ki67 Clone D3B5Cell Signaling TechnologyCat#9129; RRID: AB_2687446
Rat monoclonal anti-ki67 Clone SolA15InvitrogenCat#14-5698-82; RRID: AB_1085456
Goat polyclonal anti-CHGASanta Cruz BiotechnologyCat#sc-1488; RRID: AB_2276319
Rabbit polyclonal anti-lysozyme1Agilent DakoCat#A0099; RRID: AB_2341230
Mouse monoclonal anti-lysozyme1 Clone E-5Santa Cruz BiotechnologyCat#sc-27958; RRID: AB_2138790
Rabbit polyclonal anti-FABP1Novus BiologicalsCat#NBP1-87695; RRID: AB_1102215
Mouse monoclonal anti-FLAG Clone M2Sigma-AldrichCat#F1804; RRID: AB_262044
Rabbit polyclonal anti-beta-ActinCell Signaling TechnologyCat#4967; RRID: AB_330288
Mouse monoclonal anti-MUC2Novus BiologicalsCat#NB120-11197; RRID: AB_791261
Rabbit polyclonal anti-Mucin2Santa Cruz BiotechnologyCat#sc-15334; RRID: AB_2146667
Alexa Fluor® 488 Mouse anti-E-CadherinBD BiosciencesCat#560061; RRID: AB_1645347
BD Horizon™ BV421 Mouse Anti-E-CadherinBD BiosciencesCat#564186
Goat polyclonal anti-ACE-2R&D SystemsCat#AF933; RRID: AB_355722
Goat polyclonal antibody to tdTomato red fluorescent proteinbiorbytCat#orb182397
Rabbit monoclonal anti-Cleaved Caspase-3 Asp175 5A1ECell Signaling TechnologyCat#9664; RRID: AB_2070042
Rabbit monoclonal anti-Olfm4 Clone D6Y5ACell Signaling TechnologyCat#39141; RRID: AB_2650511
Donkey anti-Rabbit IgG H+L Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 568InvitrogenCat#A10042; RRID: AB_2534017
Donkey anti-Goat IgG H+L Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 647InvitrogenCat#A21447; RRID: AB_2535864
Donkey anti-Mouse IgG H+L Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488InvitrogenCat#A21202; RRID: AB_141607
Donkey anti-Rat IgG H+L Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 594InvitrogenCat#A21209
Alexa Fluor® 647 AffiniPure Fab Fragment Donkey Anti-Rat IgG H+LJackson ImmunoResearch LabsCat#712-606-150; RRID: AB_2340695
Alexa Fluor® 488 AffiniPure Fab Fragment Donkey Anti-Chicken IgY IgG H+LJackson ImmunoResearch LabsCat#703-546-155; RRID: AB_2340376
Donkey anti-Mouse IgG IRDye® 800CWLI-COR BiosciencesCat#926-32212
Donkey anti-Rabbit IgG IRDye® 680CWLI-COR BiosciencesCat#926-68073
Bacterial and virus strains
NEB 10-beta Competent E. coli High EfficiencyNew England BiolabsCat#C3019H
FLAG-Fgfbp1-expressing lentivirusThis paperN/A
Chemicals, peptides, and recombinant proteins
TamoxifenSigma-AldrichCat#T5648; CAS: 10540-29-1
Diphtheria Toxin from Corynebacterium DiphtheriaeSigma-AldrichCat#D0564-1MG
Advanced DMEM/F-12 ADMEM/F-12GibcoCat#12634-010
Advanced DMEM ADMEMGibcoCat#12491-015
IMDMGibcoCat#12440-053
DMEMGibcoCat#11995-065
PuromycinSigma-AldrichCat#P8833; CAS: 58-58-2
MatrigelCorningCat#356231
N-2 Supplement 100XGibcoCat#17502-048
B-27 Supplement 50XGibcoCat#17504-044
EGFPeproTechCat#AF-100-15
CHIR99021Sigma-AldrichCat#SML1046; CAS:
252917-06-9
Collagenase/DispaseSigma-AldrichCat#10269638001
Rho Kinase inhibitorTocrisCat#1254
Lipofectamine 3000 Transfection ReagentInvitrogenCat#L3000001
HistoDenz1.46Sigma-AldrichCat#D2158; CAS: 66108-95-0
Phytagel/HD1.46Sigma-AldrichCat#P8169; CAS: 71010-52-1
Antigen Unmasking Solution, Citric Acid BasedVector LaboratoriesCat#H-3300
Vectashield Plus Antifade Mounting MediumVector LaboratoriesCat#H-1900
Ready Probes Mouse on Mouse IgG Blocking SolutionInvitrogenCat#R37621
Fetal Bovine SerumR&D SystemsCat#S11150
Normal Donkey SerumJackson ImmunoResearch LabsCat#017-000-121
DAPIRocheCat#10236276001
SYTOX™ Blue Dead Cell StainInvitrogenCat#S34857
10% Neutral Buffered FormalinVWRCat#89370-094
Paraformaldehyde PFAElectron Microscopy SciencesCat#15714-S
Tissue-Tek O.C.T. CompoundSakura FinetekCat#4583
PrimocinInvivoGenCat#ant-pm-05
Penicillin-Streptomycin-Glutamine PSQ 100xGibcoCat#10378-016
Penicillin-StreptomycinGibcoCat#15140-122
100X Non-Essential Amino AcidsMP Biomedicals, LLCCat#1681049
PBS, 1XCorningCat#21-040-CM
Tween 20Fisher ScientificCat#BP337-500; CAS: 9005-64-5
Triton X-100SigmaCat#T8787; CAS: 9002-93-1
HEPES 1MGibcoCat#15630-080
UltraPure 0.5 M EDTA, pH 8.0InvitrogenCat#15575-038
GlutaMAX-I 100XGibcoCat#35050-061
TrypLE ExpressGibcoCat#12604-013
10x Tris/Glycine/SDS BufferBio-RadCat#1610732
10x Tris/Glycine BufferBio-RadCat#1610734
PageRuler Prestained Protein LadderThermo ScientificCat#26616
RIPA Lysis and Extraction BufferThermo ScientificCat#89900
cOmplete™ Protease Inhibitor CocktailMillipore SigmaCat#4693116001
Sodium Dodecyl SulfateSigma-AldrichCat#71725-50G; CAS: 151-21-3
Restriction endonucleases variousNew England BiolabsN/A
Critical commercial assays
RNeasy Mini KitQiagenCat#74106
Phusion ® High-Fidelity DNA PolymeraseNew England BiolabsCat#M0530L
ZymoPURE Plasmid Miniprep KitZymo ResearchCat#D4211
ZymoPURE II Plasmid Midiprep KitZymo ResearchCat#D4201
Zymoclean Gel DNA Recovery KitZymo ResearchCat#D4002
DNA Clean & Concentrator-5Zymo ResearchCat#4004
NEBuilder ® HiFi DNA Assembly Master MixNew England BiolabsCat#E2621L
T4 DNA LigaseNew England BiolabsCat#M0202S
Anti-Flag ® M2 Magnetic BeadsMillipore SigmaCat#M8823-1ML
RNAScope ® Multiplex Fluorescent Reagent Kit v2Advanced Cell DiagnosticsCat#323100
RNA-Protein Co-Detection Ancillary KitAdvanced Cell DiagnosticsCat#323180
RNAScope ® 4-Plex Ancillary Kit for Multiplex Fluorescent Reagent Kit v2Advanced Cell DiagnosticsCat#323120
Deposited data
Single-Cell RNA-seq of intestinal epithelial cells upon Wnt/Rspo pharmacological modulationYan et al.31GEO accession: GSE92865
Single-Cell RNA-seq of intestinal epithelial cells unperturbedHaber et al.34GEO accession: GSE92332
Single-Cell RNA-seq of intestinal epithelial cells unperturbed, enriched for secretory cell typesBöttcher et al.37GEO accession: GSE152325
Experimental models: Cell lines
HEK293T 293TATCCCat#CRL-3216; RRID: CVCL_0063
Wnt3A/RSPO1/Noggin expressing cells L-WRNATCCCat#CRL-3276; RRID: DA06
KV1 129S6_C57BL/6N HybridDr. Chyuan-Sheng Lin, Columbia UniversityN/A
Experimental models: Organisms/strains
Mouse: Lgr5-eGFP-IRES-CreERT2: B6.129P2-Lgr5tm1cre/ERT2Cle/JThe Jackson LaboratoryJAX: 008875; RRID: IMSR_JAX:008875
Mouse: Villin-CreERT2: B6.Cg-TgVil1-cre/ERT223Syr/JThe Jackson LaboratoryJAX: 020282; RRID: IMSR_JAX:020282
Mouse: Lgr5-DTR-GFPDr. Frederic de Sauvage, GenentechN/A
Mouse: Fgfbp1-CreERT2This paperN/A
Mouse: Fgfbp1-TimeRThis paperN/A
Mouse: Rosa26-CreERT2: GtROSA26Sortm1cre/ERT2Ty/JThe Jackson LaboratoryJAX: 008463; RRID: IMSR_JAX:008463
Mouse: Rosa26-Confetti: B6.129P2-GtROSA26Sortm1CAG-Brainbow2.1Cle/JThe Jackson LaboratoryJAX: 017492; RRID: IMSR_JAX:017492
Mouse: Rosa26-tdTomato: B6.Cg-GtROSA26Sortm14CAG-tdTomatoHze/JThe Jackson LaboratoryJAX: 007914; RRID: IMSR_JAX:005703
Mouse: Actin-Flpe: TgACTFLPe9205DymThe Jackson LaboratoryJAX: 005703; RRID: IMSR_JAX:005703
Oligonucleotides
RNAscope ® Mm Lgr5 probeAdvanced Cell DiagnosticsCat#312171
RNAscope ® Mm Fgfbp1 probeAdvanced Cell DiagnosticsCat#508831-C4
RNAscope ® Mm Dmbt1 probeAdvanced Cell DiagnosticsCat#418561-C2
Recombinant DNA
pMCS-DT.ADr. Kosuke Yusa, Osaka University, JapanN/A
pCS2+RZPDN/A
pLenti CMV GFP Puro 658-5Campeau et al.73Addgene: Plasmid #17448
pMD2.GDidier Trono labAddgene: Plasmid #12259
psPAX2Didier Trono labAddgene: Plasmid #12260
FLAG-Fgfbp1 lentiviral expression plasmidThis paperN/A
DsRedE2-PEST expression plasmidThis paperN/A
1xUbVR-DsRedE2-PEST expression plasmidThis paperN/A
Software and algorithms
FlowJo V10.8.1BD Bioscienceshttps://www.flowjo.com/
Leica Application Suite X LAS XLeica Microsystemshttps://www.leica-microsystems.com/products/microscope-software/p/leica-las-x-ls/
Zen blue 3.5 ZEISS ZEN liteCarl Zeiss Microscopyhttps://www.zeiss.com/microscopy/en/products/software/zeiss-zen-lite.html
Fiji/ImageJ 2.14.0; Java1.8.0_322Wayne Rasband and Contributors, National Insitutes of Health, USAhttps://imagej.org
R v4.0.3R Core Teamhttps://www.r-project.org/
Seurat v4.2.0Satija Labhttps://satijalab.org/seurat/
Nebulosa v1.0.2Alquicira-Hernandez and Powell74https://github.com/powellgenomicslab/Nebulosa
ggplot2 v3.3.6N/Ahttps://github.com/tidyverse/ggplot2
scVelo v0.2.2Bergen et al.35https://scvelo.readthedocs.io/
velocyto v.0.17Kharchenko Labhttps://velocyto.org/velocyto.py/
Python v3.7.7Python Software Foundationhttps://python.org/
Cell Ranger v5.0.010X GenomicsN/A
Prism v8.0.1GraphPad Softwarehttps://www.graphpad.com/scientific-software/prism/
Other
Odyssey CLx ImagerLI-COR BiosciencesN/A
Zeiss Confocal Microscope LSM 710Carl Zeiss MicroscopyN/A
Leica DMi8 Stellaris confocal microscopeLeica MicrosystemsN/A
Leica DMi8 Widefield microscopeLeica MicrosystemsN/A
Leica CM3050 S CryostatLeica BiosystemsN/A
Microm HM 325 MicrotomeThermo ScientificN/A
Superfrost Plus Microscope Slides White TabFisher ScientificCat#1255015
Microscope Cover GlassFisher ScientificCat#12544D
Novocyte Quanteon flow cytometerAgilentN/A
BD FACSAria II Cell SorterBD BiosystemsN/A
Amicon® Ultra-15 Centrifugal Filter UnitMilliporeCat#UFC910008

 Patterning and folding of intestinal villi by active mesenchymal dewetting.Huycke TR, Häkkinen TJ, Miyazaki H, Srivastava V, Barruet E, McGinnis CS, Kalantari A, Cornwall-Scoones J, Vaka D, Zhu Q, Jo H, Oria R, Weaver VM, DeGrado WF, Thomson M, Garikipati K, Boffelli D, Klein OD, Gartner ZJ2024 Jun 6 38781967
PMID: 38848678

Title: Isthmus progenitor cells contribute to homeostatic cellular turnover and support regeneration following intestinal injury.

Authors: Malagola E, Vasciaveo A, Ochiai Y, Kim W, Zheng B, Zanella L, Wang ALE, Middelhoff M, Nienhüser H, Deng L, Wu F, Waterbury QT, Belin B, LaBella J, Zamechek LB, Wong MH, Li L, Guha C, Cheng CW, Yan KS, Califano A, Wang TC

Journal: Cell

Publication Date: 2024 Jun 6

DOI: https://doi.org/10.1016/j.cell.2024.05.004

MeSH Terms: Animals, Regeneration, Stem Cells, Homeostasis, Mice, Intestinal Mucosa, Receptors, G-Protein-Coupled, Intestines, Cell Differentiation, Mice, Inbred C57BL, Epithelial Cells, Single-Cell Analysis, Male



All sequencing data generated in this study have been deposited on the Gene Expression Omnibus database (GEO: GSE205229 ). Original code is available at the following link: https://github.com/alevax/isthmus-progenitors-at-cell (https://doi.org/10.5281/zenodo.11040981 ). Any additional information required to reanalyze the data reported in this work paper is available from the lead contact upon request.
 Isthmus progenitor cells contribute to homeostatic cellular turnover and support regeneration following intestinal injury.Malagola E, Vasciaveo A, Ochiai Y, Kim W, Zheng B, Zanella L, Wang ALE, Middelhoff M, Nienhüser H, Deng L, Wu F, Waterbury QT, Belin B, LaBella J, Zamechek LB, Wong MH, Li L, Guha C, Cheng CW, Yan KS, Califano A, Wang TC2024 Jun 6 38848678
PMID: 38682276

Title: GPR124 regulates murine brain embryonic angiogenesis and BBB formation by an intracellular domain-independent mechanism.

Authors: Yuki K, Vallon M, Ding J, Rada CC, Tang AT, Vilches-Moure JG, McCormick AK, Henao Echeverri MF, Alwahabi S, Braunger BM, Ergün S, Kahn ML, Kuo CJ

Journal: Development

Publication Date: 2024 Jun 1

DOI: https://doi.org/10.1242/dev.202794

MeSH Terms: Animals, Blood-Brain Barrier, Neovascularization, Physiologic, Receptors, G-Protein-Coupled, Mice, Brain, Protein Domains, Mice, Knockout, Signal Transduction, Wnt Proteins, Humans, Endothelial Cells, Angiogenesis, GPI-Linked Proteins



The raw and processed RNA-seq data have been deposited in GEO under accession number GSE225367.
TrueGPR124 regulates murine brain embryonic angiogenesis and BBB formation by an intracellular domain-independent mechanism.Yuki K, Vallon M, Ding J, Rada CC, Tang AT, Vilches-Moure JG, McCormick AK, Henao Echeverri MF, Alwahabi S, Braunger BM, Ergün S, Kahn ML, Kuo CJ2024 Jun 1 38682276
PMID: 37205513

Title: Key role of down-regulated in adenoma (SLC26A3) chloride/bicarbonate exchanger in linaclotide-stimulated intestinal bicarbonate secretion upon loss of CFTR function.

Authors: Sarthi JB, Trumbull AM, Abazari SM, van Unen V, Chan JE, Jiang Y, Gammons J, Anderson MO, Cil O, Kuo CJ, Sellers ZM

Journal: bioRxiv

Publication Date: 2024 Apr 22

DOI: https://doi.org/10.1101/2023.05.05.539132

MeSH Terms: No Mesh Terms available



The authors declare that the data supporting the findings of this study are available within the paper and its supplementary information files. Any further information on the data in this study are available by reasonable request to the corresponding author.
TrueKey role of down-regulated in adenoma (SLC26A3) chloride/bicarbonate exchanger in linaclotide-stimulated intestinal bicarbonate secretion upon loss of CFTR function.Sarthi JB, Trumbull AM, Abazari SM, van Unen V, Chan JE, Jiang Y, Gammons J, Anderson MO, Cil O, Kuo CJ, Sellers ZM2024 Apr 22 37205513
PMID: 38349111

Title: Mechanisms driving fasting-induced protection from genotoxic injury in the small intestine.

Authors: Deans-Fielder K, Wu T, Nguyen T, To S, Huang YZ, Bark SJ, Mills JC, Shroyer NF

Journal: Am J Physiol Gastrointest Liver Physiol

Publication Date: 2024 May 1

DOI: https://doi.org/10.1152/ajpgi.00126.2023

MeSH Terms: Mice, Animals, Intestine, Small, Intestines, Mechanistic Target of Rapamycin Complex 1, DNA Adducts, Fasting, Doxorubicin



Source data for this study are openly available at GEO, accession: GSE245477.
 Mechanisms driving fasting-induced protection from genotoxic injury in the small intestine.Deans-Fielder K, Wu T, Nguyen T, To S, Huang YZ, Bark SJ, Mills JC, Shroyer NF2024 May 1 38349111
PMID: 38321203

Title: Epithelial zonation along the mouse and human small intestine defines five discrete metabolic domains.

Authors: Zwick RK, Kasparek P, Palikuqi B, Viragova S, Weichselbaum L, McGinnis CS, McKinley KL, Rathnayake A, Vaka D, Nguyen V, Trentesaux C, Reyes E, Gupta AR, Gartner ZJ, Locksley RM, Gardner JM, Itzkovitz S, Boffelli D, Klein OD

Journal: Nat Cell Biol

Publication Date: 2024 Feb

DOI: https://doi.org/10.1038/s41556-023-01337-z

MeSH Terms: Humans, Mice, Animals, Intestine, Small, Duodenum, Intestines, Jejunum, Ileum, Mammals



The datasets generated and analysed in the current study are available in the Gene Expression Omnibus (GEO; BioProject accession code GSE201859) and can be visualized using the Chan Zuckerberg CELLxGENE tool (https://cellxgene.cziscience.com/collections/3db5617e-9f12-4eb4-8416-94893a0d7c46). Previously published single-cell sequencing data6 analysed here are available under accession code GSE92332. Source data and analysis outputs are provided in the Supplementary Information associated with this publication. All other data supporting the findings of this study are available from the corresponding author on reasonable request.

Custom code developed for this manuscript is available in Zenodo under record no. 10223562.

 Epithelial zonation along the mouse and human small intestine defines five discrete metabolic domains.Zwick RK, Kasparek P, Palikuqi B, Viragova S, Weichselbaum L, McGinnis CS, McKinley KL, Rathnayake A, Vaka D, Nguyen V, Trentesaux C, Reyes E, Gupta AR, Gartner ZJ, Locksley RM, Gardner JM, Itzkovitz S, Boffelli D, Klein OD2024 Feb 38321203
PMID: 38337789

Title: Near-Infrared In Vivo Imaging of Claudin-1 Expression by Orthotopically Implanted Patient-Derived Colonic Adenoma Organoids.

Authors: Jaiswal S, Wang F, Wu X, Chang TS, Shirazi A, Lee M, Dame MK, Spence JR, Wang TD

Journal: Diagnostics (Basel)

Publication Date: 2024 Jan 26

DOI: https://doi.org/10.3390/diagnostics14030273

MeSH Terms: No Mesh Terms available



The reported data, including the Supplementary Materials, are available from the corresponding authors upon request.
TrueNear-Infrared In Vivo Imaging of Claudin-1 Expression by Orthotopically Implanted Patient-Derived Colonic Adenoma Organoids.Jaiswal S, Wang F, Wu X, Chang TS, Shirazi A, Lee M, Dame MK, Spence JR, Wang TD2024 Jan 26 38337789
PMID: 38291503

Title: deMULTIplex2: robust sample demultiplexing for scRNA-seq.

Authors: Zhu Q, Conrad DN, Gartner ZJ

Journal: Genome Biol

Publication Date: 2024 Jan 30

DOI: https://doi.org/10.1186/s13059-024-03177-y

MeSH Terms: Single-Cell Gene Expression Analysis, Single-Cell Analysis, Algorithms, Sequence Analysis, RNA, High-Throughput Nucleotide Sequencing



Demultiplex2 is available as an R package at https://github.com/Gartner-Lab/deMULTIplex2and Zenodo (https://zenodo.org/record/8429613) under the Creative Commons Attribution 4.0 International License (https://creativecommons.org/licenses/by/4.0/). The code for benchmarking deMULTIplex2 has also been deposited to github (https:// github.com/Gartner-Lab/deMULTIplex2-benchmark) and Zenodo (https://zenodo.org/record/8429628). Datasets used for benchmarking are all publicly available. The 8-donor PBMC MULTI-seq and SCMK dataset from McGinnis et al., 2021 can be downloaded from NCBI GEO with accession number GSE161329. The 4-cell line and 8-donor Page 23 of 24Zhu et al. Genome Biology (2024) 25:37 PBMC datasets from Stoeckius et al., 2018 can be accessed through GSE108313. The tag count matrix for 8-donor single-nucleus human brain cortex from Gaublomme et al. can be accessed through docker image at https://hub.docker.com/r/regevlab/demuxem. The three batches of multi-donor bronchoalveolar lavage (BAL) datasets from Howitt et al. and Maksimovic et al. and the human lung cell line dataset from Howitt et al. can be downloaded from https://github.com/Oshlack/hashtag-demux-paper/tree/main/data/. The PDX dataset from Winkler et al. can be downloaded from NCBI GEO with accession number GSE210283.
TruedeMULTIplex2: robust sample demultiplexing for scRNA-seq.Zhu Q, Conrad DN, Gartner ZJ2024 Jan 30 38291503
PMID: 38042929

Title: Role of PDGFRA(+) cells and a CD55(+) PDGFRA(Lo) fraction in the gastric mesenchymal niche.

Authors: Manieri E, Tie G, Malagola E, Seruggia D, Madha S, Maglieri A, Huang K, Fujiwara Y, Zhang K, Orkin SH, Wang TC, He R, McCarthy N, Shivdasani RA

Journal: Nat Commun

Publication Date: 2023 Dec 2

DOI: https://doi.org/10.1038/s41467-023-43619-y

MeSH Terms: Mice, Animals, Stomach, Gastric Mucosa, Stem Cells, Intestines, Pyloric Antrum, Receptor Protein-Tyrosine Kinases, Epithelial Cells



The sequencing data generated in this study have been deposited in the Gene Expression Omnibus (GEO) repository under accession code GSE224737. This study includes analysis of previously published data, referenced with GEO accession number GSE130681, ArrayExpress accession numbers E-MTAB-6879, and NCBI Sequence Read Archive SRP227356 . Any additional information required to reanalyze data reported in this paper is available from the corresponding author upon request. Source data are provided with this paper.
TrueRole of PDGFRA(+) cells and a CD55(+) PDGFRA(Lo) fraction in the gastric mesenchymal niche.Manieri E, Tie G, Malagola E, Seruggia D, Madha S, Maglieri A, Huang K, Fujiwara Y, Zhang K, Orkin SH, Wang TC, He R, McCarthy N, Shivdasani RA2023 Dec 2 38042929
PMID: 37865088

Title: TGFB1 induces fetal reprogramming and enhances intestinal regeneration.

Authors: Chen L, Qiu X, Dupre A, Pellon-Cardenas O, Fan X, Xu X, Rout P, Walton KD, Burclaff J, Zhang R, Fang W, Ofer R, Logerfo A, Vemuri K, Bandyopadhyay S, Wang J, Barbet G, Wang Y, Gao N, Perekatt AO, Hu W, Magness ST, Spence JR, Verzi MP

Journal: Cell Stem Cell

Publication Date: 2023 Nov 2

DOI: https://doi.org/10.1016/j.stem.2023.09.015

MeSH Terms: Animals, Humans, Mice, Colon, Intestinal Mucosa, Intestines, Organoids, Signal Transduction, Transforming Growth Factor beta1



Single-cell RNA-seq, RNA-seq and ATAC-seq data have been deposited at GEO and are publicly available as of the date of publication. Accession numbers are listed in the key resources table. This paper analyzes existing, publicly available data. These accession numbers for the datasets are listed in the key resources table. This paper does not report original code.

RNA-seq, scRNA-seq and ATAC-seq data:  GSE222505

RNA-seq of crypts upon IR:  Qu et al., 2021,  GSE165157

scRNA-seq of normal crypts and irradiated crypts:  Ayyaz et al., 2019,  GSE117783

scRNA-seq of duodenum/jejunum boundary samples upon IR:  GSE165318

scRNA-seq of sorted Msi1-GFP positive cells (irradiation-resistant) and their progeny cells upon IR:   Sheng et al., 2020, GSE145866

SMAD4 ChIP in mouse intestinal epithelium:  Chen et al., 2019,  GSE112946

Any additional information required to reanalyze the data reported in this work paper is available from the lead contact upon request.

 TGFB1 induces fetal reprogramming and enhances intestinal regeneration.Chen L, Qiu X, Dupre A, Pellon-Cardenas O, Fan X, Xu X, Rout P, Walton KD, Burclaff J, Zhang R, Fang W, Ofer R, Logerfo A, Vemuri K, Bandyopadhyay S, Wang J, Barbet G, Wang Y, Gao N, Perekatt AO, Hu W, Magness ST, Spence JR, Verzi MP2023 Nov 2 37865088
PMID: 37922878

Title: Development of functional resident macrophages in human pluripotent stem cell-derived colonic organoids and human fetal colon.

Authors: Múnera JO, Kechele DO, Bouffi C, Qu N, Jing R, Maity P, Enriquez JR, Han L, Campbell I, Mahe MM, McCauley HA, Zhang X, Sundaram N, Hudson JR, Zarsozo-Lacoste A, Pradhan S, Tominaga K, Sanchez JG, Weiss AA, Chatuvedi P, Spence JR, Hachimi M, North T, Daley GQ, Mayhew CN, Hu YC, Takebe T, Helmrath MA, Wells JM

Journal: Cell Stem Cell

Publication Date: 2023 Nov 2

DOI: https://doi.org/10.1016/j.stem.2023.10.002

MeSH Terms: Humans, Mice, Animals, Pluripotent Stem Cells, Hematopoietic Stem Cells, Colon, Organoids, Macrophages



Bulk RNA-seq and scRNA-seq datasets generated in this study are publicly available in NCBI’s Gene Expression Omnibus (GEO): GSE240363. All accession numbers used in this study are listed in the key resources table. All scRNA-seq analysis was performed in R using previously generated codes, which are referenced in the key resource table. This paper does not report original code. Additional information, original images, digital scans of cytospins, or scripts needed for further analysis are available upon request.
 Development of functional resident macrophages in human pluripotent stem cell-derived colonic organoids and human fetal colon.Múnera JO, Kechele DO, Bouffi C, Qu N, Jing R, Maity P, Enriquez JR, Han L, Campbell I, Mahe MM, McCauley HA, Zhang X, Sundaram N, Hudson JR, Zarsozo-Lacoste A, Pradhan S, Tominaga K, Sanchez JG, Weiss AA, Chatuvedi P, Spence JR, Hachimi M, North T, Daley GQ, Mayhew CN, Hu YC, Takebe T, Helmrath MA, Wells JM2023 Nov 2 37922878
PMID: 37909332

Title: Human intestinal organoids from Cronkhite-Canada syndrome patients reveal link between serotonin and proliferation.

Authors: Poplaski V, Bomidi C, Kambal A, Nguyen-Phuc H, Di Rienzi SC, Danhof HA, Zeng XL, Feagins LA, Deng N, Vilar E, McAllister F, Coarfa C, Min S, Kim HJ, Shukla R, Britton R, Estes MK, Blutt SE

Journal: J Clin Invest

Publication Date: 2023 Nov 1

DOI: https://doi.org/10.1172/JCI166884

MeSH Terms: Humans, Serotonin, Intestines, Organoids, Colorectal Neoplasms, Intestinal Polyposis



The RNA-Seq data generated in this study are deposited in the Gene Expression Omnibus database: CCS and Non-CCS HIOs, GSE207838; NGN3 HIOs, GSE138350; and FAP and Healthy Patients, GSE153385, GSE156172, GSE106500. Codes are available from the corresponding author upon request. Raw data is available in an associated Supporting Data Values file
TrueHuman intestinal organoids from Cronkhite-Canada syndrome patients reveal link between serotonin and proliferation.Poplaski V, Bomidi C, Kambal A, Nguyen-Phuc H, Di Rienzi SC, Danhof HA, Zeng XL, Feagins LA, Deng N, Vilar E, McAllister F, Coarfa C, Min S, Kim HJ, Shukla R, Britton R, Estes MK, Blutt SE2023 Nov 1 37909332
PMID: 37884859

Title: Integrative genome-scale analyses reveal post-transcriptional signatures of early human small intestinal development in a directed differentiation organoid model.

Authors: Hung YH, Capeling M, Villanueva JW, Kanke M, Shanahan MT, Huang S, Cubitt R, Rinaldi VD, Schimenti JC, Spence JR, Sethupathy P

Journal: BMC Genomics

Publication Date: 2023 Oct 26

DOI: https://doi.org/10.1186/s12864-023-09743-1

MeSH Terms: Humans, Animals, Mice, Gene Expression Regulation, Developmental, Cell Differentiation, MicroRNAs, Intestine, Small, Organoids



The small RNA-seq data generated from this study is available through GEO accession GSE207467. ChRO-seq and bulk RNA-seq data have been generated previously and available through GEO accession GSE142316. For the single cell RNA-seq analyses, the data of wild type and whole body miR-375 knockout mice is available through GSE178826 and GSE208224, respectively. We established an interactive web server called ProHumID (https://sethupathy-lab.shinyapps.io/ProHumID/) for users to explore sequencing data generated from this study.
TrueIntegrative genome-scale analyses reveal post-transcriptional signatures of early human small intestinal development in a directed differentiation organoid model.Hung YH, Capeling M, Villanueva JW, Kanke M, Shanahan MT, Huang S, Cubitt R, Rinaldi VD, Schimenti JC, Spence JR, Sethupathy P2023 Oct 26 37884859
PMID: 37790430

Title: Epithelial zonation along the mouse and human small intestine defines five discrete metabolic domains.

Authors: Zwick RK, Kasparek P, Palikuqi B, Viragova S, Weichselbaum L, McGinnis CS, McKinley KL, Rathnayake A, Vaka D, Nguyen V, Trentesaux C, Reyes E, Gupta AR, Gartner ZJ, Locksley RM, Gardner JM, Itzkovitz S, Boffelli D, Klein OD

Journal: bioRxiv

Publication Date: 2023 Sep 22

DOI: pii: 2023.09.20.558726. doi: 10.1101/2023.09.20.558726

MeSH Terms: No Mesh Terms available



No data and code information found in the publication.
 Epithelial zonation along the mouse and human small intestine defines five discrete metabolic domains.Zwick RK, Kasparek P, Palikuqi B, Viragova S, Weichselbaum L, McGinnis CS, McKinley KL, Rathnayake A, Vaka D, Nguyen V, Trentesaux C, Reyes E, Gupta AR, Gartner ZJ, Locksley RM, Gardner JM, Itzkovitz S, Boffelli D, Klein OD2023 Sep 22 37790430
PMID: 37643009

Title: Epithelial TNF controls cell differentiation and CFTR activity to maintain intestinal mucin homeostasis.

Authors: Reyes EA, Castillo-Azofeifa D, Rispal J, Wald T, Zwick RK, Palikuqi B, Mujukian A, Rabizadeh S, Gupta AR, Gardner JM, Boffelli D, Gartner ZJ, Klein OD

Journal: J Clin Invest

Publication Date: 2023 Oct 16

DOI: https://doi.org/10.1172/JCI163591

MeSH Terms: Humans, Animals, Mice, Mucins, Cystic Fibrosis Transmembrane Conductance Regulator, Tumor Necrosis Factor Inhibitors, Epithelial Cells, Cell Differentiation, Tumor Necrosis Factors, Homeostasis



Values for all data points are available in the Supporting Data Values file. FACS experiments and analysis. RKZ and BP processed and shared human donor ileal histological samples. AM and SR generated the histological panel of IBD patient samples. ARG and JMG procured human adult intestinal tissue from donors. DB provided bioinformatics support. EAR, DCA, and JR wrote the manuscript. All authors contributed to editing and review of the manuscript.
TrueEpithelial TNF controls cell differentiation and CFTR activity to maintain intestinal mucin homeostasis.Reyes EA, Castillo-Azofeifa D, Rispal J, Wald T, Zwick RK, Palikuqi B, Mujukian A, Rabizadeh S, Gupta AR, Gardner JM, Boffelli D, Gartner ZJ, Klein OD2023 Oct 16 37643009
PMID: 37403628

Title: Understanding and Overcoming Immunosuppression Shaped by Cancer Stem Cells.

Authors: Li L, Jensen RA

Journal: Cancer Res

Publication Date: 2023 Jul 5

DOI: https://doi.org/10.1158/0008-5472.CAN-23-0230

MeSH Terms: Humans, Prospective Studies, Neoplasms, Immunosuppression Therapy, Immunotherapy, Neoplastic Stem Cells, Tumor Microenvironment



No data and code information found in the publication.
TrueUnderstanding and Overcoming Immunosuppression Shaped by Cancer Stem Cells.Li L, Jensen RA2023 Jul 5 37403628
PMID: 37268690

Title: Therapeutic blood-brain barrier modulation and stroke treatment by a bioengineered FZD(4)-selective WNT surrogate in mice.

Authors: Ding J, Lee SJ, Vlahos L, Yuki K, Rada CC, van Unen V, Vuppalapaty M, Chen H, Sura A, McCormick AK, Tomaske M, Alwahabi S, Nguyen H, Nowatzke W, Kim L, Kelly L, Vollrath D, Califano A, Yeh WC, Li Y, Kuo CJ

Journal: Nat Commun

Publication Date: 2023 Jun 2

DOI: https://doi.org/10.1038/s41467-023-37689-1

MeSH Terms: Mice, Animals, Blood-Brain Barrier, Frizzled Receptors, Retina, Blood-Retinal Barrier, Wnt Signaling Pathway



The bulk RNA-seq and scRNA-seq data sets generated in this study have been deposited in Gene Expression Omnibus with the accession code GSE223628 and GSE223498 individually. Bulk RNA data were aligned to Ensembl mouse genome using Kallisto (v 0.44.0) with default parameters. Source data and the raw data of graphs in the figures in this study is provided in Source Data files with this paper. Other raw data are available immediately upon request. Source data are provided with this paper.
Scripts to perform analyses of scRNA-seq data are provided with this paper. Custom code is available on GitHub (https://github.com/ califano-lab/NDP-KO-SC) and on Zenodo as well http://zenodo.org/badge/latestdoi/592882572.

TrueTherapeutic blood-brain barrier modulation and stroke treatment by a bioengineered FZD(4)-selective WNT surrogate in mice.Ding J, Lee SJ, Vlahos L, Yuki K, Rada CC, van Unen V, Vuppalapaty M, Chen H, Sura A, McCormick AK, Tomaske M, Alwahabi S, Nguyen H, Nowatzke W, Kim L, Kelly L, Vollrath D, Califano A, Yeh WC, Li Y, Kuo CJ2023 Jun 2 37268690
PMID: 37425793

Title: Patterning and folding of intestinal villi by active mesenchymal dewetting.

Authors: Huycke TR, Miyazaki H, Häkkinen TJ, Srivastava V, Barruet E, McGinnis CS, Kalantari A, Cornwall-Scoones J, Vaka D, Zhu Q, Jo H, DeGrado WF, Thomson M, Garikipati K, Boffelli D, Klein OD, Gartner ZJ

Journal: bioRxiv

Publication Date: 2023 Aug 15

DOI: pii: 2023.06.25.546328. doi: 10.1101/2023.06.25.546328

MeSH Terms: No Mesh Terms available



Original codes for the C-H and SPV models of mesenchymal aggregation are available at https://github.com/tjhakkin/GutCH and https://github.com/Gartner-Lab/GutSPV. Raw scRNA-seq/MULTI-seq data are available through the following GEO Accession number: GSE233407 All other primary data or additional information required to reanalyze data reported here are available upon request.
TruePatterning and folding of intestinal villi by active mesenchymal dewetting.Huycke TR, Miyazaki H, Häkkinen TJ, Srivastava V, Barruet E, McGinnis CS, Kalantari A, Cornwall-Scoones J, Vaka D, Zhu Q, Jo H, DeGrado WF, Thomson M, Garikipati K, Boffelli D, Klein OD, Gartner ZJ2023 Aug 15 37425793
PMID: 37070767

Title: Transplanted human intestinal organoids: a resource for modeling human intestinal development.

Authors: Singh A, Poling HM, Chaturvedi P, Thorner K, Sundaram N, Kechele DO, Childs CJ, McCauley HA, Fisher GW, Brown NE, Spence JR, Wells JM, Helmrath MA

Journal: Development

Publication Date: 2023 May 1

DOI: https://doi.org/10.1242/dev.201416

MeSH Terms: Animals, Humans, Intestines, Intestinal Mucosa, Organoids, Pluripotent Stem Cells, Cell Differentiation



All sequencing data in this paper can be viewed at: https://research.cchmc.org/Shiny-Akaljot/. Raw files of all single nucleus datasets generated as part of this work are available in Gene Expression Omnibus under accession number GSE226925. Raw files for the single-cell sequencing that was performed on tHIOs are available in Gene Expression Omnibus under accession number GSE214852. Raw files that were used in the construction of the reference atlas are available in ArrayExpress under accession numbers E-MTAB-8901 and E-MTAB-10187 and in Gene Expression Omnibus under accession number GSE158702.
TrueTransplanted human intestinal organoids: a resource for modeling human intestinal development.Singh A, Poling HM, Chaturvedi P, Thorner K, Sundaram N, Kechele DO, Childs CJ, McCauley HA, Fisher GW, Brown NE, Spence JR, Wells JM, Helmrath MA2023 May 1 37070767
PMID: 36703617

Title: Transferrin Receptor-Mediated Iron Uptake Promotes Colon Tumorigenesis.

Authors: Kim H, Villareal LB, Liu Z, Haneef M, Falcon DM, Martin DR, Lee HJ, Dame MK, Attili D, Chen Y, Varani J, Spence JR, Kovbasnjuk O, Colacino JA, Lyssiotis CA, Lin HC, Shah YM, Xue X

Journal: Adv Sci (Weinh)

Publication Date: 2023 Apr

DOI: https://doi.org/10.1002/advs.202207693

MeSH Terms: Humans, beta Catenin, Iron, Tankyrases, Colonic Neoplasms, Carcinogenesis, Cell Transformation, Neoplastic, Receptors, Transferrin



The data that support the findings of this study are available from the corresponding author upon reasonable request.
TrueTransferrin Receptor-Mediated Iron Uptake Promotes Colon Tumorigenesis.Kim H, Villareal LB, Liu Z, Haneef M, Falcon DM, Martin DR, Lee HJ, Dame MK, Attili D, Chen Y, Varani J, Spence JR, Kovbasnjuk O, Colacino JA, Lyssiotis CA, Lin HC, Shah YM, Xue X2023 Apr 36703617
PMID: 37028407

Title: Graded BMP signaling within intestinal crypt architecture directs self-organization of the Wnt-secreting stem cell niche.

Authors: Kraiczy J, McCarthy N, Malagola E, Tie G, Madha S, Boffelli D, Wagner DE, Wang TC, Shivdasani RA

Journal: Cell Stem Cell

Publication Date: 2023 Apr 6

DOI: https://doi.org/10.1016/j.stem.2023.03.004

MeSH Terms: Animals, Mice, Intestinal Mucosa, Stem Cell Niche, Intestines, Signal Transduction, Cell Differentiation, Cell Proliferation



Sequencing data have been deposited in the Gene Expression Omnibus (GEO) repository under the accession numbers GSE211275 and GSE212601 as listed in the Key Resources Table. Data are publicly available as of the date of publication. This study includes analysis of previously published data, referenced with the accession numbers in the Key Resources Table. This study used custom functions in a Python environment (3.7.13) available at Zenodo, DOI:10.5281/zenodo.7686568 Any additional information required to reanalyze data reported in this paper is available from the lead contact upon request.
 Graded BMP signaling within intestinal crypt architecture directs self-organization of the Wnt-secreting stem cell niche.Kraiczy J, McCarthy N, Malagola E, Tie G, Madha S, Boffelli D, Wagner DE, Wang TC, Shivdasani RA2023 Apr 6 37028407
PMID: 36912192

Title: Fibroblast-derived EGF ligand neuregulin 1 induces fetal-like reprogramming of the intestinal epithelium without supporting tumorigenic growth.

Authors: Lemmetyinen TT, Viitala EW, Wartiovaara L, Kaprio T, Hagström J, Haglund C, Katajisto P, Wang TC, Domènech-Moreno E, Ollila S

Journal: Dis Model Mech

Publication Date: 2023 Apr 1

DOI: https://doi.org/10.1242/dmm.049692

MeSH Terms: Humans, Carcinogenesis, Epidermal Growth Factor, Fibroblasts, Intestinal Mucosa, Ligands, Neuregulin-1, Cellular Reprogramming



RNA sequencing data have been deposited at the Gene Expression Omnibus under the accession number GSE200704.
TrueFibroblast-derived EGF ligand neuregulin 1 induces fetal-like reprogramming of the intestinal epithelium without supporting tumorigenic growth.Lemmetyinen TT, Viitala EW, Wartiovaara L, Kaprio T, Hagström J, Haglund C, Katajisto P, Wang TC, Domènech-Moreno E, Ollila S2023 Apr 1 36912192
PMID: 36924771

Title: Smooth muscle contributes to the development and function of a layered intestinal stem cell niche.

Authors: McCarthy N, Tie G, Madha S, He R, Kraiczy J, Maglieri A, Shivdasani RA

Journal: Dev Cell

Publication Date: 2023 Apr 10

DOI: https://doi.org/10.1016/j.devcel.2023.02.012

MeSH Terms: Humans, Mice, Animals, Stem Cell Niche, Intestines, Intestinal Mucosa, Cell Differentiation, Bone Morphogenetic Proteins, Muscle, Smooth



Data are deposited in the Gene Expression Omnibus (GSE184158). No new software was developed for this study. Any additional information required to reanalyze the data reported in this work paper is available from the Lead Contact upon request.
 Smooth muscle contributes to the development and function of a layered intestinal stem cell niche.McCarthy N, Tie G, Madha S, He R, Kraiczy J, Maglieri A, Shivdasani RA2023 Apr 10 36924771
PMID: 36634827

Title: F4/80(+)Ly6C(high) Macrophages Lead to Cell Plasticity and Cancer Initiation in Colitis.

Authors: Shin AE, Tesfagiorgis Y, Larsen F, Derouet M, Zeng PYF, Good HJ, Zhang L, Rubinstein MR, Han YW, Kerfoot SM, Nichols AC, Hayakawa Y, Howlett CJ, Wang TC, Asfaha S

Journal: Gastroenterology

Publication Date: 2023 Apr

DOI: https://doi.org/10.1053/j.gastro.2023.01.002

MeSH Terms: Animals, Mice, Azoxymethane, Carcinogenesis, Cell Plasticity, Colitis, Colitis-Associated Neoplasms, Dextran Sulfate, Disease Models, Animal, Inflammation, Macrophages, Mice, Inbred C57BL



RNA-sequencing matrix files have been deposited in the National Institutes of Health Gene Expression Omnibus database and can be accessed at PRJNA910503. All data are available in the main text or the Supplementary Materials.
 F4/80(+)Ly6C(high) Macrophages Lead to Cell Plasticity and Cancer Initiation in Colitis.Shin AE, Tesfagiorgis Y, Larsen F, Derouet M, Zeng PYF, Good HJ, Zhang L, Rubinstein MR, Han YW, Kerfoot SM, Nichols AC, Hayakawa Y, Howlett CJ, Wang TC, Asfaha S2023 Apr 36634827
PMID: 36779454

Title: An Engineered Living Intestinal Muscle Patch Produces Macroscopic Contractions that can Mix and Break Down Artificial Intestinal Contents.

Authors: Wang Q, Wang J, Tokhtaeva E, Li Z, Martín MG, Ling XB, Dunn JCY

Journal: Adv Mater

Publication Date: 2023 Apr

DOI: https://doi.org/10.1002/adma.202207255

MeSH Terms: Humans, Muscle, Smooth, Gastrointestinal Contents, Intestines, Tissue Engineering, Muscle Contraction, Biological Factors



RNA-seq data have been submitted to the NCBI GEO under the accession number GSE223116. Further information and requests for data should be directed to the corresponding authors.
 An Engineered Living Intestinal Muscle Patch Produces Macroscopic Contractions that can Mix and Break Down Artificial Intestinal Contents.Wang Q, Wang J, Tokhtaeva E, Li Z, Martín MG, Ling XB, Dunn JCY2023 Apr 36779454
PMID: 37090649

Title: deMULTIplex2: robust sample demultiplexing for scRNA-seq.

Authors: Zhu Q, Conrad DN, Gartner ZJ

Journal: bioRxiv

Publication Date: 2023 Apr 12

DOI: pii: 2023.04.11.536275. doi: 10.1101/2023.04.11.536275

MeSH Terms: No Mesh Terms available



Demultiplex2 is available as an R package at https://github.com/Gartner-622 Lab/deMULTIplex2 under the Creative Commons Attribution-NonCommercial-623 NoDerivatives 4.0 International License (http://creativecommons.org/licenses/by-nc-624nd/4.0/).
TruedeMULTIplex2: robust sample demultiplexing for scRNA-seq.Zhu Q, Conrad DN, Gartner ZJ2023 Apr 12 37090649
PMID: 36821371

Title: EPIREGULIN creates a developmental niche for spatially organized human intestinal enteroids.

Authors: Childs CJ, Holloway EM, Sweet CW, Tsai YH, Wu A, Vallie A, Eiken MK, Capeling MM, Zwick RK, Palikuqi B, Trentesaux C, Wu JH, Pellón-Cardenas O, Zhang CJ, Glass I, Loebel C, Yu Q, Camp JG, Sexton JZ, Klein OD, Verzi MP, Spence JR

Journal: JCI Insight

Publication Date: 2023 Mar 22

DOI: https://doi.org/10.1172/jci.insight.165566

MeSH Terms: Humans, Epidermal Growth Factor, Epiregulin, Intestines, Intestinal Mucosa, Cell Differentiation



Sequencing data generated and used by this study are deposited at EMBL-EBI ArrayExpress. Data sets for human fetal intestine (ArrayExpress: E-MTAB-9489, and previously published work: ref. 13), scRNA-Seq of human fetal intestinal enteroids (ArrayExpress: E-MTAB-11912), and dual snRNA/snATAC-Seq multiomic data of human fetal intestinal enteroids (ArrayExpress: E-MTAB-11908) have been deposited. Code used to process raw data can be found at https://github.com/jason-spence-lab/Childs_2022 (commit ID c8bd5a7).
TrueEPIREGULIN creates a developmental niche for spatially organized human intestinal enteroids.Childs CJ, Holloway EM, Sweet CW, Tsai YH, Wu A, Vallie A, Eiken MK, Capeling MM, Zwick RK, Palikuqi B, Trentesaux C, Wu JH, Pellón-Cardenas O, Zhang CJ, Glass I, Loebel C, Yu Q, Camp JG, Sexton JZ, Klein OD, Verzi MP, Spence JR2023 Mar 22 36821371
PMID: 36640764

Title: A DLG1-ARHGAP31-CDC42 axis is essential for the intestinal stem cell response to fluctuating niche Wnt signaling.

Authors: Castillo-Azofeifa D, Wald T, Reyes EA, Gallagher A, Schanin J, Vlachos S, Lamarche-Vane N, Bomidi C, Blutt S, Estes MK, Nystul T, Klein OD

Journal: Cell Stem Cell

Publication Date: 2023 Feb 2

DOI: https://doi.org/10.1016/j.stem.2022.12.008

MeSH Terms: Animals, Mice, Cell Proliferation, GTPase-Activating Proteins, Intestinal Mucosa, Intestines, Stem Cell Niche, Stem Cells, Wnt Signaling Pathway



Bulk RNA-seq data have been deposited at GEO and are publicly available as of the date of publication. Accession numbers are listed in the key resources table. Microscopy data reported in this paper will be shared by the lead contact upon request. This paper does not report original code. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
 A DLG1-ARHGAP31-CDC42 axis is essential for the intestinal stem cell response to fluctuating niche Wnt signaling.Castillo-Azofeifa D, Wald T, Reyes EA, Gallagher A, Schanin J, Vlachos S, Lamarche-Vane N, Bomidi C, Blutt S, Estes MK, Nystul T, Klein OD2023 Feb 2 36640764
PMID: 36798304

Title: Defining the structure, signals, and cellular elements of the gastric mesenchymal niche.

Authors: Manieri E, Tie G, Seruggia D, Madha S, Maglieri A, Huang K, Fujiwara Y, Zhang K, Orkin SH, He R, McCarthy N, Shivdasani RA

Journal: bioRxiv

Publication Date: 2023 Feb 24

DOI: pii: 2023.02.11.527728. doi: 10.1101/2023.02.11.527728

MeSH Terms: No Mesh Terms available



Sequencing data have been deposited in the Gene Expression Omnibus (GEO) repository under the accession numbers listed in the Key Resources Table. Data will be publicly available as of the date of publication. This study includes analysis of previously published data, referenced with the accession numbers in the Key Resources Table. Any additional information required to reanalyze data reported in this paper is available from the lead contact upon request.
 Defining the structure, signals, and cellular elements of the gastric mesenchymal niche.Manieri E, Tie G, Seruggia D, Madha S, Maglieri A, Huang K, Fujiwara Y, Zhang K, Orkin SH, He R, McCarthy N, Shivdasani RA2023 Feb 24 36798304
PMID: 36702898

Title: In vivo development of immune tissue in human intestinal organoids transplanted into humanized mice.

Authors: Bouffi C, Wikenheiser-Brokamp KA, Chaturvedi P, Sundaram N, Goddard GR, Wunderlich M, Brown NE, Staab JF, Latanich R, Zachos NC, Holloway EM, Mahe MM, Poling HM, Vales S, Fisher GW, Spence JR, Mulloy JC, Zorn AM, Wells JM, Helmrath MA

Journal: Nat Biotechnol

Publication Date: 2023 Jun

DOI: https://doi.org/10.1038/s41587-022-01558-x

MeSH Terms: Humans, Animals, Mice, Intestines, Intestinal Mucosa, Organoids, Pluripotent Stem Cells, Transplants



Data are available on FlowRepository with ID no. FR-FCM-Z3L6. All the analysis code has been deposited to GitHub: https://github.com/praneet1988/Analyze_CyTOF_Using_Seurat.
TrueIn vivo development of immune tissue in human intestinal organoids transplanted into humanized mice.Bouffi C, Wikenheiser-Brokamp KA, Chaturvedi P, Sundaram N, Goddard GR, Wunderlich M, Brown NE, Staab JF, Latanich R, Zachos NC, Holloway EM, Mahe MM, Poling HM, Vales S, Fisher GW, Spence JR, Mulloy JC, Zorn AM, Wells JM, Helmrath MA2023 Jun 36702898
PMID: 36711781

Title: TGFB1 Induces Fetal Reprogramming and Enhances Intestinal Regeneration.

Authors: Chen L, Dupre A, Qiu X, Pellon-Cardenas O, Walton KD, Wang J, Perekatt AO, Hu W, Spence JR, Verzi MP

Journal: bioRxiv

Publication Date: 2023 Jan 13

DOI: pii: 2023.01.13.523825. doi: 10.1101/2023.01.13.523825

MeSH Terms: No Mesh Terms available



All RNA-seq, scRNA-seq and ATAC-seq data of this study have been deposited in GEO (GSE222505). The following datasets from GEO were reanalyzed with our sequencing data: the accession number for the SMAD4 ChIP in mouse intestinal epithelium from our previous studies is GSE112946 (Chen et al., 2019). Bulk RNA-seq of GSE165157 (Qu et al., 2021) was used to analyze crypt transcriptome upon IR at days 0, 1, 2, 3 and 5. scRNA-seq of GSE117783 (Ayyaz et al., 2019) was used to compare normal crypts and irradiated crypt cells after 3 days of irradiation. scRNA-seq of GSE165318 was used to analyze duodenum/jejunum boundary samples collected at days 0, 1, 3, 7, and 14 after irradiation. scRNA-seq of GSE145866 (Sheng et al., 2020) was used to analyze sorted Msi1-GFP positive cells (irradiation-resistant) and their progeny cells upon irradiation.
TrueTGFB1 Induces Fetal Reprogramming and Enhances Intestinal Regeneration.Chen L, Dupre A, Qiu X, Pellon-Cardenas O, Walton KD, Wang J, Perekatt AO, Hu W, Spence JR, Verzi MP2023 Jan 13 36711781
PMID: 36317629

Title: R-spondin 3 governs secretory differentiation in the gastric oxyntic glands.

Authors: Kurokawa K, Wang TC, Hayakawa Y

Journal: J Clin Invest

Publication Date: 2022 Nov 1

DOI: https://doi.org/10.1172/JCI163380

MeSH Terms: Mice, Animals, Gastric Mucosa, Cell Differentiation, Stem Cells, Organoids, Stem Cell Niche



No data and code information found in the publication.
TrueR-spondin 3 governs secretory differentiation in the gastric oxyntic glands.Kurokawa K, Wang TC, Hayakawa Y2022 Nov 1 36317629
PMID: 36214410

Title: Approaches to benchmark and characterize in vitro human model systems.

Authors: Childs CJ, Eiken MK, Spence JR

Journal: Development

Publication Date: 2022 Oct 15

DOI: https://doi.org/10.1242/dev.200641

MeSH Terms: Benchmarking, Humans, Organogenesis, Organoids



No data and code information found in the publication.
 Approaches to benchmark and characterize in vitro human model systems.Childs CJ, Eiken MK, Spence JR2022 Oct 15 36214410
PMID: 35803312

Title: Using Human Induced Pluripotent Stem Cell-Derived Organoids to Identify New Pathologies in Patients With PDX1 Mutations.

Authors: Krishnamurthy M, Kechele DO, Broda T, Zhang X, Enriquez JR, McCauley HA, Sanchez JG, McCracken K, Palermo J, Bernieh A, Collins MH, Thomas IH, Neef HC, Heider A, Dauber A, Wells JM

Journal: Gastroenterology

Publication Date: 2022 Oct

DOI: https://doi.org/10.1053/j.gastro.2022.06.083

MeSH Terms: Cell Differentiation, Humans, Induced Pluripotent Stem Cells, Metaplasia, Mutation, Organoids, Stomach



No data and code information found in the publication.
 Using Human Induced Pluripotent Stem Cell-Derived Organoids to Identify New Pathologies in Patients With PDX1 Mutations.Krishnamurthy M, Kechele DO, Broda T, Zhang X, Enriquez JR, McCauley HA, Sanchez JG, McCracken K, Palermo J, Bernieh A, Collins MH, Thomas IH, Neef HC, Heider A, Dauber A, Wells JM2022 Oct 35803312
PMID: 36191054

Title: Human neutrophil IL1ß directs intestinal epithelial cell extrusion during Salmonella infection.

Authors: Lawrence AE, Berger RP, Hill DR, Huang S, Yadagiri VK, Bons B, Fields C, Sule GJ, Knight JS, Wobus CE, Spence JR, Young VB, O'Riordan MX, Abuaita BH

Journal: PLoS Pathog

Publication Date: 2022 Oct

DOI: https://doi.org/10.1371/journal.ppat.1010855

MeSH Terms: Animals, Humans, Mice, Caspases, Epithelial Cells, Intestinal Mucosa, Neutrophils, Salmonella Infections, Salmonella typhimurium



All relevant data are within the manuscript and its Supporting Information files . Reagents and resources can be obtained by directing requests to [email protected]
TrueHuman neutrophil IL1ß directs intestinal epithelial cell extrusion during Salmonella infection.Lawrence AE, Berger RP, Hill DR, Huang S, Yadagiri VK, Bons B, Fields C, Sule GJ, Knight JS, Wobus CE, Spence JR, Young VB, O'Riordan MX, Abuaita BH2022 Oct 36191054
PMID: 35919990

Title: Orthovoltage X-Rays Exhibit Increased Efficacy Compared with ?-Rays in Preclinical Irradiation.

Authors: Bell BI, Vercellino J, Brodin NP, Velten C, Nanduri LSY, Nagesh PKB, Tanaka KE, Fang Y, Wang Y, Macedo R, English J, Schumacher MM, Duddempudi PK, Asp P, Koba W, Shajahan S, Liu L, Tomé WA, Yang WL, Kolesnick R, Guha C

Journal: Cancer Res

Publication Date: 2022 Aug 3

DOI: https://doi.org/10.1158/0008-5472.CAN-22-0656

MeSH Terms: Animals, Cesium Radioisotopes, Gamma Rays, Mice, Whole-Body Irradiation, X-Rays



The data generated in this study are available upon request from the corresponding author.
 Orthovoltage X-Rays Exhibit Increased Efficacy Compared with ?-Rays in Preclinical Irradiation.Bell BI, Vercellino J, Brodin NP, Velten C, Nanduri LSY, Nagesh PKB, Tanaka KE, Fang Y, Wang Y, Macedo R, English J, Schumacher MM, Duddempudi PK, Asp P, Koba W, Shajahan S, Liu L, Tomé WA, Yang WL, Kolesnick R, Guha C2022 Aug 3 35919990
PMID: 35931034

Title: Lymphangiocrine signals are required for proper intestinal repair after cytotoxic injury.

Authors: Palikuqi B, Rispal J, Reyes EA, Vaka D, Boffelli D, Klein O

Journal: Cell Stem Cell

Publication Date: 2022 Aug 4

DOI: https://doi.org/10.1016/j.stem.2022.07.007

MeSH Terms: Cell Proliferation, Endothelial Cells, Epithelial Cells, Intestinal Mucosa, Intestines, Stem Cells



All scRNAseq data have been deposited on the Gene Expression Omnibus (GEO) and can be viewed under accession number GSE198469. This manuscript did not generate any new code. Any additional information required to reanalyze the data reported in this work is available from the lead contact upon request.
 Lymphangiocrine signals are required for proper intestinal repair after cytotoxic injury.Palikuqi B, Rispal J, Reyes EA, Vaka D, Boffelli D, Klein O2022 Aug 4 35931034
PMID: 35905739

Title: Aggregation of cryopreserved mid-hindgut endoderm for more reliable and reproducible hPSC-derived small intestinal organoid generation.

Authors: Pitstick AL, Poling HM, Sundaram N, Lewis PL, Kechele DO, Sanchez JG, Scott MA, Broda TR, Helmrath MA, Wells JM, Mayhew CN

Journal: Stem Cell Reports

Publication Date: 2022 Aug 9

DOI: https://doi.org/10.1016/j.stemcr.2022.06.011

MeSH Terms: Cell Differentiation, Endoderm, Humans, Intestine, Small, Organoids, Pluripotent Stem Cells



Supplemental information can be found online at https://doi.org/10.1016/j.stemcr.2022.06.011.
TrueAggregation of cryopreserved mid-hindgut endoderm for more reliable and reproducible hPSC-derived small intestinal organoid generation.Pitstick AL, Poling HM, Sundaram N, Lewis PL, Kechele DO, Sanchez JG, Scott MA, Broda TR, Helmrath MA, Wells JM, Mayhew CN2022 Aug 9 35905739
PMID: 35767358

Title: R-spondin signaling in the stomach: isthmal Lgr4 rules.

Authors: Malagola E, Hayakawa Y, Wang TC

Journal: EMBO J

Publication Date: 2022 Jul 4

DOI: https://doi.org/10.15252/embj.2022111696

MeSH Terms: Receptors, G-Protein-Coupled, Signal Transduction, Stem Cells, Stomach, Thrombospondins, Wnt Signaling Pathway



No data and code information found in the publication.
 R-spondin signaling in the stomach: isthmal Lgr4 rules.Malagola E, Hayakawa Y, Wang TC2022 Jul 4 35767358