PMID:
39727412
Title:
Loss of mucin 2 and MHC II molecules causes rare resistance to murine RV infection.
Authors:
Bomidi C, Sawyer FM, Shroyer N, Conner M, Estes MK, Blutt SE
Journal:
J Virol
Publication Date:
2025 Feb 25
DOI:
https://doi.org/10.1128/jvi.01507-24
MeSH Terms: Animals, Mice, Mice, Knockout, Rotavirus Infections, Goblet Cells, Mucin-2, Rotavirus, Histocompatibility Antigens Class II, Basic Helix-Loop-Helix Transcription Factors, Enterocytes, Paneth Cells, Disease Resistance, Mice, Inbred C57BL
|
Previously published sequencing data from scRNA-seq (29) are available on NCBI. The GEO accession number for the scRNA-seq data re-analyzed in this paper is GSE145827.
| | Loss of mucin 2 and MHC II molecules causes rare resistance to murine RV infection. | Bomidi C, Sawyer FM, Shroyer N, Conner M, Estes MK, Blutt SE | 2025 Feb 25 | | 39727412 |
PMID:
39896606
Title:
Dynamic Reprogramming of Stromal Pdgfra-expressing cells during WNT-Mediated Transformation of the Intestinal Epithelium.
Authors:
Pellon-Cardenas O, Rout P, Hassan S, Fokas E, Ping H, Patel I, Patel J, Plotsker O, Wu A, Kumar R, Akther M, Logerfo A, Wu S, Wagner DE, Boffelli D, Walton KD, Manieri E, Tong K, Spence JR, Bessman NJ, Shivdasani RA, Verzi MP
Journal:
bioRxiv
Publication Date:
2025 Jan 25
DOI:
https://doi.org/10.1101/2025.01.22.634326
MeSH Terms: No Mesh Terms available
|
No data and code information found in the publication.
| | Dynamic Reprogramming of Stromal Pdgfra-expressing cells during WNT-Mediated Transformation of the Intestinal Epithelium. | Pellon-Cardenas O, Rout P, Hassan S, Fokas E, Ping H, Patel I, Patel J, Plotsker O, Wu A, Kumar R, Akther M, Logerfo A, Wu S, Wagner DE, Boffelli D, Walton KD, Manieri E, Tong K, Spence JR, Bessman NJ, Shivdasani RA, Verzi MP | 2025 Jan 25 | | 39896606 |
PMID:
39701210
Title:
Deriving Human Intestinal Organoids with Functional Tissue-Resident Macrophages All From Pluripotent Stem Cells.
Authors:
Tominaga K, Kechele DO, Sanchez JG, Vales S, Jurickova I, Roman L, Asai A, Enriquez JR, McCauley HA, Kishimoto K, Iwasawa K, Singh A, Horio Y, Múnera JO, Takebe T, Zorn AM, Helmrath MA, Denson LA, Wells JM
Journal:
Cell Mol Gastroenterol Hepatol
Publication Date:
2025
DOI:
https://doi.org/10.1016/j.jcmgh.2024.101444
MeSH Terms: Humans, Organoids, Macrophages, Animals, Pluripotent Stem Cells, Cell Differentiation, Mice, Coculture Techniques, Intestines, Phagocytosis, Gene Expression Profiling, Intestinal Mucosa
|
No data and code information found in the publication.
| | Deriving Human Intestinal Organoids with Functional Tissue-Resident Macrophages All From Pluripotent Stem Cells. | Tominaga K, Kechele DO, Sanchez JG, Vales S, Jurickova I, Roman L, Asai A, Enriquez JR, McCauley HA, Kishimoto K, Iwasawa K, Singh A, Horio Y, Múnera JO, Takebe T, Zorn AM, Helmrath MA, Denson LA, Wells JM | 2025 | | 39701210 |
PMID:
39007612
Title:
Using Human Intestinal Organoids to Understand the Small Intestine Epithelium at the Single Cell Transcriptional Level.
Authors:
Bomidi C, Zeng XL, Poplaski V, Coarfa C, Estes MK, Blutt SE
Journal:
J Vis Exp
Publication Date:
2024 Jun 28
DOI:
https://doi.org/10.3791/66749
MeSH Terms: Humans, Organoids, Intestine, Small, Single-Cell Analysis, Intestinal Mucosa, Gene Expression Profiling, Transcriptome
|
No data and code information found in the publication.
| | Using Human Intestinal Organoids to Understand the Small Intestine Epithelium at the Single Cell Transcriptional Level. | Bomidi C, Zeng XL, Poplaski V, Coarfa C, Estes MK, Blutt SE | 2024 Jun 28 | | 39007612 |
PMID:
39036707
Title:
Mechanical stimulation promotes human intestinal villus morphogenesis in vivo.
Authors:
Poling HM, Brown N, Wells JM, Barrile R, Helmrath MA, Mahe MM
Journal:
Biophys Rev (Melville)
Publication Date:
2024 Sep
DOI:
https://doi.org/10.1063/5.0221220
MeSH Terms: No Mesh Terms available
|
No data and code information found in the publication.
| | Mechanical stimulation promotes human intestinal villus morphogenesis in vivo. | Poling HM, Brown N, Wells JM, Barrile R, Helmrath MA, Mahe MM | 2024 Sep | | 39036707 |
PMID:
39270642
Title:
Human pluripotent stem cell-derived organoids repair damaged bowel in vivo.
Authors:
Poling HM, Sundaram N, Fisher GW, Singh A, Shiley JR, Nattamai K, Govindarajah V, Cortez AR, Krutko MO, Ménoret S, Anegon I, Kasendra M, Wells JM, Mayhew CN, Takebe T, Mahe MM, Helmrath MA
Journal:
Cell Stem Cell
Publication Date:
2024 Oct 3
DOI:
https://doi.org/10.1016/j.stem.2024.08.009
MeSH Terms: Organoids, Humans, Pluripotent Stem Cells, Animals, Intestine, Small, Mice, Regeneration, Rats
|
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|
| Antibodies |
|---|
| Ki-67 Monoclonal Antibody (SolA15), eBioscience™ | ThermoFisher | Cat#14-5698-82; RRID: AB_10854564 | | FABP1 (D2A3X) XP® Rabbit mAb | Cell Signaling Technology | Cat#13368S; RRID: AB_2798192 | | Anti-Lysozyme antibody | Abcam | Cat#ab108508; RRID: AB_10861277 | | Anti-MUC2 antibody | Abcam | Cat#ab272692; RRID: AB_2888616 | | Anti-Chromogranin A antibody | Abcam | Cat#ab45179; RRID: AB_726879 | | Anti-DCAMKL1 antibody | Abcam | Cat#ab37994; RRID: AB_873538 | | Active/Pro-Caspase 3 Recombinant Rabbit Monoclonal Antibody (ARC0133) | ThermoFisher | Cat#MA5-35333; RRID: AB_2849235 | | GFP Antibody | Rockland | Cat#600-101-215; RRID: AB_218182 | | RFP Antibody Pre-adsorbed | Rockland | Cat#600-401-379; RRID: AB_2209751 | | Olfm4 (D6Y5A) XP® Rabbit mAb | Cell Signaling Technology | Cat#39141S; RRID: AB_2650511 | | a-Tubulin Antibody | Cell Signaling Technology | Cat#2144S; RRID: AB_2210548 | | RNA pol II antibody (mAb) | ACTIVE MOTIF | Cat#39497; RRID: AB_2732926 | | Histone H3K4me3 antibody (pAb) | ACTIVE MOTIF | Cat#39497; RRID: AB_2615077 | | H3K27me3 Antibody | EpiCypher | Cat# 13-0055; RRID: AB_3665059 | | Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 546 | ThermoFisher | Cat#A10040; RRID: AB_2534016 | | Donkey anti-Goat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488 | ThermoFisher | Cat#A11055; RRID: AB_2534102 | | Donkey anti-Rat IgG (H+L) Cross-Adsorbed Secondary Antibody, DyLight™ 550 | ThermoFisher | Cat#SA5-10027; RRID: AB_2556607 | | Chemicals, peptides, and recombinant proteins |
|---|
| Recombinant Murine Noggin | PeproTech | Cat#250-38 | | Recombinant Murine EGF | PeproTech | Cat# 315-09 | | Recombinant Mouse R-Spondin 1 (CHO-expressed) Protein | R&D Systems | Cat#7150-RS-250/CF | | N-Acetyl-L-cysteine | MilliporeSigma | Cat#A9165 | | Advanced DMEM/F-12 | ThermoFisher | Cat#12634010 | | N-2 Supplement (100X) | ThermoFisher | Cat#17502048 | | B-27™ Supplement (50X), serum free | ThermoFisher | Cat#17504044 | | HEPES (1 M) | ThermoFisher | Cat#15630080 | | GlutaMAX™ Supplement | ThermoFisher | Cat#35050061 | | DMEM, high glucose | ThermoFisher | Cat#11965092 | | TrypLE™ Express Enzyme (1X), no phenol red | ThermoFisher | Cat#12604021 | | Corning® Matrigel® Matrix for Organoid Culture, Phenol Red-free, LDEV-free | Corning | Cat#356231 | | 4-Hydroxytamoxifen Ready Made Solution | MilliporeSigma | Cat#SML1666 | | Recombinant Mouse Wnt-3a Protein | R&D Systems | Cat#1324-WN-010/CF | | Recombinant Human/Mouse Wnt-5a Protein | R&D Systems | Cat#645-WN-010/CF | | Y-27632 dihydrochloride | MilliporeSigma | Cat#Y0503 | | Opal 520 Reagent Pack | AKOYA | Cat#FP1487001KT | | Opal 570 Reagent Pack | AKOYA | Cat#FP1488001KT | | Opal 690 Reagent Pack | AKOYA | Cat#FP1497001KT | | HBSS, no calcium, no magnesium | ThermoFisher | Cat#14170120 | | Intercept® (TBS) Blocking Buffer and Diluent Kit | LI-COR | Cat#927-66003 | | cOmplete™, EDTA-free Protease Inhibitor Cocktail | MilliporeSigma | Cat#11873580001 | | TWEEN® 20 | MilliporeSigma | Cat#P9416 | | 4–15% Mini-PROTEAN® TGX Stain-Free™ Protein Gels | Biorad | Cat#4568084 | | Immun-Blot® Low Fluorescence PVDF Membrane | Biorad | Cat#1620264 | | Gentle Cell Dissociation Reagent | Stem Cell Technology | Cat#100-0485 | | Fluoro-Gel Mounting Medium with Tris Buffer | Electron Microscopy Sciences | Cat#17985-10 | | DAPI | MilliporeSigma | Cat#D9542 | | ProLong™ Gold Antifade Mountant with DAPI | ThermoFisher | Cat#P36935 | | Universal blocking buffer (10X) | BioGenex | Cat#HK085-5K | | Critical commercial assays |
|---|
| RNAscope™ Multiplex Fluorescent Detection Kit v2 | ACD | Cat#323110 | | Dead Cell Removal Kit | Miltenyi Biotec | Cat#130-090-101 | | CUTANA™ CUT&Tag Kit | EpiCypher | Cat#14-1102 | | RNeasy Mini Kit | QIAGEN | Cat#74104 | | CellTiter-Glo® 3D Cell Viability Assay | Promega | Cat#G9681 | | High-Capacity cDNA Reverse Transcription Kit | ThermoFisher | Cat#4368814 | | Fast SYBR™ Green Master Mix | ThermoFisher | Cat#4385612 | | Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle | 10X Genomics | Cat#PN-1000283 | | Chromium Next GEM Single Cell 3 GEM, Library & Gel Bead Kit v3.1 | 10X Genomics | Cat#PN-1000121 | | Deposited data |
|---|
| Raw and analyzed sequencing data | This paper | GEO: GSE221421 | | Original western blot images | This paper | Mendeley data: https://data.mendeley.com/datasets/27n3yh5wbs/1 | | Experimental models: Cell lines |
|---|
| 293T | ATCC | Cat# CRL-3216 | | Experimental models: Organisms/strains |
|---|
| Mouse: C57BL/6J | The Jackson Laboratory | 000664 | | Mouse: Lgr5EGFP-IRES-Cre-ER (B6.129P2-Lgr5tm1(cre/ERT2)Cle/J) | The Jackson Laboratory | 008875 | | Mouse: Fzd5 | van Es et al. | N/A | | Mouse: Villin-Cre-ER | el Marjou et al. | N/A | | Mouse: Krt19-Cre-ER | Means et al. | N/A | | Mouse: ROSA (B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J) | The Jackson Laboratory | 007914 | | Mouse: mT/mG (Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J) | The Jackson Laboratory | 007576 | | Mouse: Fzd5-IRES-Dre-ER-P2A-tdTomato | This paper | N/A | | Oligonucleotides |
|---|
| Quantitative real-time PCR primers (See Table S1) | Integrated DNA Technologies | N/A | | TRC Lentiviral shRNA targeting Fzd7(mouse) | Horizon discovery | Cat#RMM4534-EG14369 | | Primer for genotyping Fzd5-reporter mouse: WT-F: 5’- CATCACGTCGGGAGTCTGGATCTG -3’ | This paper | N/A | | WT-R: 5’- CCAACAGTAACCTCATTACAATGCC -3’ | This paper | N/A | | Mut-R 5’- CCTAGGAATGCTCGTCAAGAAGACAG -3’ | This paper | N/A | | RNAscope™ Probe- Mm-Fzd5 | ACD | Cat#404911 | | RNAscope™ Probe- Mm-Ascl2-C2 | ACD | Cat#412211-C2 | | RNAscope™ Probe- Mm-Krt19-C2 | ACD | Cat#402941-C2 | | RNAscope™ Probe- Mm-LGR5-C3 | ACD | Cat#312171-C3 | | Software and algorithms |
|---|
| FlowJo | https://www.flowjo.com/ | N/A | | Fiji | https://fiji.sc/ | N/A | | Cellranger (v4.0) | https://www.10xgenomics.com/ | N/A | | GraphPad Prism 9 | https://www.graphpad.com/ | N/A | | Seurat (version 4.1.1) | Hao et al. | N/A | | Signac (version 1.13) | Stuart et al. | N/A | | Harmony (version 0.1.0) | Korsunsky et al. | N/A | | scVelo(version 0.2.5) | Bergen et al. | N/A | | Other |
|---|
| ODYSSEY® DLx | LI-COR | N/A | | BD FACSMelody™ Cell Sorter | BD | N/A | | BD Influx™ Cell Sorter | BD | N/A | | Singulator 100 | S2 Genomics | N/A |
| | Human pluripotent stem cell-derived organoids repair damaged bowel in vivo. | Poling HM, Sundaram N, Fisher GW, Singh A, Shiley JR, Nattamai K, Govindarajah V, Cortez AR, Krutko MO, Ménoret S, Anegon I, Kasendra M, Wells JM, Mayhew CN, Takebe T, Mahe MM, Helmrath MA | 2024 Oct 3 | | 39270642 |
PMID:
39048815
Title:
A human autoimmune organoid model reveals IL-7 function in coeliac disease.
Authors:
Santos AJM, van Unen V, Lin Z, Chirieleison SM, Ha N, Batish A, Chan JE, Cedano J, Zhang ET, Mu Q, Guh-Siesel A, Tomaske M, Colburg D, Varma S, Choi SS, Christophersen A, Baghdasaryan A, Yost KE, Karlsson K, Ha A, Li J, Dai H, Sellers ZM, Chang HY, Dunn JCY, Zhang BM, Mellins ED, Sollid LM, Fernandez-Becker NQ, Davis MM, Kuo CJ
Journal:
Nature
Publication Date:
2024 Aug
DOI:
https://doi.org/10.1038/s41586-024-07716-2
MeSH Terms: Humans, Autoantibodies, Autoimmunity, B-Lymphocytes, Biopsy, Celiac Disease, Duodenum, Epitopes, Glutens, GTP-Binding Proteins, HLA-DQ Antigens, Interleukin-7, Intestinal Mucosa, Killer Cells, Natural, Models, Biological, Myeloid Cells, Organoids, Protein Glutamine gamma Glutamyltransferase 2, Receptors, Antigen, B-Cell, Receptors, Antigen, T-Cell, T-Lymphocytes
|
No data and code information found in the publication.
| | A human autoimmune organoid model reveals IL-7 function in coeliac disease. | Santos AJM, van Unen V, Lin Z, Chirieleison SM, Ha N, Batish A, Chan JE, Cedano J, Zhang ET, Mu Q, Guh-Siesel A, Tomaske M, Colburg D, Varma S, Choi SS, Christophersen A, Baghdasaryan A, Yost KE, Karlsson K, Ha A, Li J, Dai H, Sellers ZM, Chang HY, Dunn JCY, Zhang BM, Mellins ED, Sollid LM, Fernandez-Becker NQ, Davis MM, Kuo CJ | 2024 Aug | | 39048815 |
PMID:
39257805
Title:
Regulatory network analysis of Dclk1 gene expression reveals a tuft cell-ILC2 axis that inhibits pancreatic tumor progression.
Authors:
Valenti G, Laise P, Takahashi R, Wu F, Ruan T, Vasciaveo A, Jiang Z, Sunagawa M, Middelhoff M, Nienhüser H, Fu N, Malagola E, Hayakawa Y, Iuga AC, Califano A, Wang TC
Journal:
bioRxiv
Publication Date:
2024 Oct 12
DOI:
pii: 2024.08.30.610508. doi: 10.1101/2024.08.30.610508
MeSH Terms: No Mesh Terms available
|
No data and code information found in the publication.
| | Regulatory network analysis of Dclk1 gene expression reveals a tuft cell-ILC2 axis that inhibits pancreatic tumor progression. | Valenti G, Laise P, Takahashi R, Wu F, Ruan T, Vasciaveo A, Jiang Z, Sunagawa M, Middelhoff M, Nienhüser H, Fu N, Malagola E, Hayakawa Y, Iuga AC, Califano A, Wang TC | 2024 Oct 12 | | 39257805 |
PMID:
39579769
Title:
Frizzled5 controls murine intestinal epithelial cell plasticity through organization of chromatin accessibility.
Authors:
Deng L, He XC, Chen S, Zhang N, Deng F, Scott A, He Y, Tsuchiya D, Smith SE, Epp M, Malloy S, Liu F, Hembree M, Mu Q, Haug JS, Malagola E, Hassan H, Petentler K, Egidy R, Maddera L, Russell J, Wang Y, Li H, Zhao C, Perera A, Wang TC, Kuo CJ, Li L
Journal:
Dev Cell
Publication Date:
2024 Nov 15
DOI:
https://doi.org/10.1016/j.devcel.2024.10.021
MeSH Terms: No Mesh Terms available
|
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|
| Antibodies |
|---|
| Ki-67 Monoclonal Antibody (SolA15), eBioscience™ | ThermoFisher | Cat#14-5698-82; RRID: AB_10854564 | | FABP1 (D2A3X) XP® Rabbit mAb | Cell Signaling Technology | Cat#13368S; RRID: AB_2798192 | | Anti-Lysozyme antibody [EPR2994(2)] | Abcam | Cat#ab108508; RRID: AB_10861277 | | Anti-MUC2 antibody [EPR23479-47] | Abcam | Cat#ab272692; RRID: AB_2888616 | | Anti-Chromogranin A antibody | Abcam | Cat#ab45179; RRID: AB_726879 | | Anti-DCAMKL1 antibody | Abcam | Cat#ab37994; RRID: AB_873538 | | Active/Pro-Caspase 3 Recombinant Rabbit Monoclonal Antibody (ARC0133) | ThermoFisher | Cat#MA5-35333; RRID: AB_2849235 | | GFP Antibody | Rockland | Cat#600-101-215; RRID: AB_218182 | | RFP Antibody Pre-adsorbed | Rockland | Cat#600-401-379; RRID: AB_2209751 | | Olfm4 (D6Y5A) XP® Rabbit mAb | Cell Signaling Technology | Cat#39141S; RRID: AB_2650511 | | a-Tubulin Antibody | Cell Signaling Technology | Cat#2144S; RRID: AB_2210548 | | RNA pol II antibody (mAb) | ACTIVE MOTIF | Cat#39497; RRID: AB_2732926 | | Histone H3K4me3 antibody (pAb) | ACTIVE MOTIF | Cat#39497; RRID: AB_2615077 | | H3K27me3 Antibody | EpiCypher | Cat# 13-0055; RRID: AB_3665059 | | Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 546 | ThermoFisher | Cat#A10040; RRID: AB_2534016 | | Donkey anti-Goat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488 | ThermoFisher | Cat#A11055; RRID: AB_2534102 | | Donkey anti-Rat IgG (H+L) Cross-Adsorbed Secondary Antibody, DyLight™ 550 | ThermoFisher | Cat#SA5-10027; RRID: AB_2556607 | | Chemicals, peptides, and recombinant proteins |
|---|
| Recombinant Murine Noggin | PeproTech | Cat#250-38 | | Recombinant Murine EGF | PeproTech | Cat# 315-09 | | Recombinant Mouse R-Spondin 1 (CHO-expressed) Protein | R&D Systems | Cat#7150-RS-250/CF | | N-Acetyl-L-cysteine | MilliporeSigma | Cat#A9165 | | Advanced DMEM/F-12 | ThermoFisher | Cat#12634010 | | N-2 Supplement (100X) | ThermoFisher | Cat#17502048 | | B-27™ Supplement (50X), serum free | ThermoFisher | Cat#17504044 | | HEPES (1 M) | ThermoFisher | Cat#15630080 | | GlutaMAX™ Supplement | ThermoFisher | Cat#35050061 | | DMEM, high glucose | ThermoFisher | Cat#11965092 | | TrypLE™ Express Enzyme (1X), no phenol red | ThermoFisher | Cat#12604021 | | Corning® Matrigel® Matrix for Organoid Culture, Phenol Red-free, LDEV-free | Corning | Cat#356231 | | 4-Hydroxytamoxifen Ready Made Solution | MilliporeSigma | Cat#SML1666 | | Recombinant Mouse Wnt-3a Protein | R&D Systems | Cat#1324-WN-010/CF | | Recombinant Human/Mouse Wnt-5a Protein | R&D Systems | Cat#645-WN-010/CF | | Y-27632 dihydrochloride | MilliporeSigma | Cat#Y0503 | | Opal 520 Reagent Pack | AKOYA | Cat#FP1487001KT | | Opal 570 Reagent Pack | AKOYA | Cat#FP1488001KT | | Opal 690 Reagent Pack | AKOYA | Cat#FP1497001KT | | HBSS, no calcium, no magnesium | ThermoFisher | Cat#14170120 | | Intercept® (TBS) Blocking Buffer and Diluent Kit | LI-COR | Cat#927-66003 | | cOmplete™, EDTA-free Protease Inhibitor Cocktail | MilliporeSigma | Cat#11873580001 | | TWEEN® 20 | MilliporeSigma | Cat#P9416 | | 4–15% Mini-PROTEAN® TGX Stain-Free™ Protein Gels | Biorad | Cat#4568084 | | Immun-Blot® Low Fluorescence PVDF Membrane | Biorad | Cat#1620264 | | Gentle Cell Dissociation Reagent | Stem Cell Technology | Cat#100-0485 | | Fluoro-Gel Mounting Medium with Tris Buffer | Electron Microscopy Sciences | Cat#17985-10 | | DAPI | MilliporeSigma | Cat#D9542 | | ProLong™ Gold Antifade Mountant with DAPI | ThermoFisher | Cat#P36935 | | Universal blocking buffer (10X) | BioGenex | Cat#HK085-5K | | Critical commercial assays |
|---|
| RNAscope™ Multiplex Fluorescent Detection Kit v2 | ACD | Cat#323110 | | Dead Cell Removal Kit | Miltenyi Biotec | Cat#130-090-101 | | CUTANA™ CUT&Tag Kit | EpiCypher | Cat#14-1102 | | RNeasy Mini Kit | QIAGEN | Cat#74104 | | CellTiter-Glo® 3D Cell Viability Assay | Promega | Cat#G9681 | | High-Capacity cDNA Reverse Transcription Kit | ThermoFisher | Cat#4368814 | | Fast SYBR™ Green Master Mix | ThermoFisher | Cat#4385612 | | Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle | 10X Genomics | Cat#PN-1000283 | | Chromium Next GEM Single Cell 3' GEM, Library & Gel Bead Kit v3.1 | 10X Genomics | Cat#PN-1000121 | | Deposited data |
|---|
| Raw and analyzed sequencing data | This paper | GEO: GSE221421 | | Original western blot images | This paper | Mendeley data: https://data.mendeley.com/datasets/27n3yh5wbs/1 | | Experimental models: Cell lines |
|---|
| 293T | ATCC | Cat# CRL-3216 | | Experimental models: Organisms/strains |
|---|
| Mouse: C57BL/6J | The Jackson Laboratory | 000664 | | Mouse: Lgr5EGFP-IRES-Cre-ERT2 (B6.129P2-Lgr5tm1(cre/ERT2)Cle/J) | The Jackson Laboratory | 008875 | | Mouse: Fzd5flox/flox | van Es et al.26 | N/A | | Mouse: Villin-Cre-ERT2 | el Marjou et al. 39 | N/A | | Mouse: Krt19-Cre-ERT2 | Means et al.40 | N/A | | Mouse: ROSAtdTomato (B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J) | The Jackson Laboratory | 007914 | | Mouse: mT/mG (Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J) | The Jackson Laboratory | 007576 | | Mouse: Fzd5-IRES-Dre-ERT2-P2A-tdTomato | This paper | N/A | | Oligonucleotides |
|---|
| Quantitative real-time PCR primers (See Table S1) | Integrated DNA Technologies | N/A | | TRC Lentiviral shRNA targeting Fzd7(mouse) | Horizon discovery | Cat#RMM4534-EG14369 | | Primer for genotyping Fzd5-reporter mouse: WT-F: 5’- CATCACGTCGGGAGTCTGGATCTG -3’ | This paper | N/A | | WT-R: 5’- CCAACAGTAACCTCATTACAATGCC -3’ | This paper | N/A | | Mut-R 5’- CCTAGGAATGCTCGTCAAGAAGACAG -3’ | This paper | N/A | | RNAscope™ Probe- Mm-Fzd5 | ACD | Cat#404911 | | RNAscope™ Probe- Mm-Ascl2-C2 | ACD | Cat#412211-C2 | | RNAscope™ Probe- Mm-Krt19-C2 | ACD | Cat#402941-C2 | | RNAscope™ Probe- Mm-LGR5-C3 | ACD | Cat#312171-C3 | | Software and algorithms |
|---|
| FlowJo | https://www.flowjo.com/ | N/A | | Fiji | https://fiji.sc/ | N/A | | Cellranger (v4.0) | https://www.10xgenomics.com/ | N/A | | GraphPad Prism 9 | https://www.graphpad.com/ | N/A | | Seurat (version 4.1.1) | Hao et al.41 | N/A | | Signac (version 1.13) | Stuart et al.42 | N/A | | Harmony (version 0.1.0) | Korsunsky et al.48 | N/A | | scVelo(version 0.2.5) | Bergen et al.30 | N/A | | Other |
|---|
| ODYSSEY® DLx | LI-COR | N/A | | BD FACSMelody™ Cell Sorter | BD | N/A | | BD Influx™ Cell Sorter | BD | N/A | | Singulator 100 | S2 Genomics | N/A |
| | Frizzled5 controls murine intestinal epithelial cell plasticity through organization of chromatin accessibility. | Deng L, He XC, Chen S, Zhang N, Deng F, Scott A, He Y, Tsuchiya D, Smith SE, Epp M, Malloy S, Liu F, Hembree M, Mu Q, Haug JS, Malagola E, Hassan H, Petentler K, Egidy R, Maddera L, Russell J, Wang Y, Li H, Zhao C, Perera A, Wang TC, Kuo CJ, Li L | 2024 Nov 15 | | 39579769 |
PMID:
39579768
Title:
FZD5 controls intestinal crypt homeostasis and colonic Wnt surrogate agonist response.
Authors:
Mu Q, Ha A, Santos AJM, Lo YH, van Unen V, Miao Y, Tomaske M, Guzman VK, Alwahabi S, Yuan JJ, Deng L, Li L, Garcia KC, Kuo CJ
Journal:
Dev Cell
Publication Date:
2024 Nov 19
DOI:
https://doi.org/10.1016/j.devcel.2024.10.022
MeSH Terms: No Mesh Terms available
|
No data and code information found in the publication.
| | FZD5 controls intestinal crypt homeostasis and colonic Wnt surrogate agonist response. | Mu Q, Ha A, Santos AJM, Lo YH, van Unen V, Miao Y, Tomaske M, Guzman VK, Alwahabi S, Yuan JJ, Deng L, Li L, Garcia KC, Kuo CJ | 2024 Nov 19 | | 39579768 |
PMID:
38848677
Title:
Time-resolved fate mapping identifies the intestinal upper crypt zone as an origin of Lgr5+ crypt base columnar cells.
Authors:
Capdevila C, Miller J, Cheng L, Kornberg A, George JJ, Lee H, Botella T, Moon CS, Murray JW, Lam S, Calderon RI, Malagola E, Whelan G, Lin CS, Han A, Wang TC, Sims PA, Yan KS
Journal:
Cell
Publication Date:
2024 Jun 6
DOI:
https://doi.org/10.1016/j.cell.2024.05.001
MeSH Terms: Receptors, G-Protein-Coupled, Animals, Mice, Intestinal Mucosa, Stem Cells, Cell Lineage, Regeneration, Cell Proliferation, Epithelial Cells, Mice, Inbred C57BL, Homeostasis
|
| REAGENT or RESOURCE | SOURCE | IDENTIFIER | | Antibodies |
|---|
| Rabbit polyclonal anti-RFP pre-adsorbed | Rockland | Cat#600-401-379; RRID: AB_2209751 | | Anti-mTagBFP2 single domain antibody | NanoTag Biotechnologies | Cat#N0502-AF647-L | | Chicken polyclonal anti-GFP | Aveslabs | Cat#GFP-1020; RRID: AB_2307313 | | Rabbit monoclonal anti-Ki67 Clone D3B5 | Cell Signaling Technology | Cat#9129; RRID: AB_2687446 | | Rat monoclonal anti-ki67 Clone SolA15 | Invitrogen | Cat#14-5698-82; RRID: AB_1085456 | | Goat polyclonal anti-CHGA | Santa Cruz Biotechnology | Cat#sc-1488; RRID: AB_2276319 | | Rabbit polyclonal anti-lysozyme1 | Agilent Dako | Cat#A0099; RRID: AB_2341230 | | Mouse monoclonal anti-lysozyme1 Clone E-5 | Santa Cruz Biotechnology | Cat#sc-27958; RRID: AB_2138790 | | Rabbit polyclonal anti-FABP1 | Novus Biologicals | Cat#NBP1-87695; RRID: AB_1102215 | | Mouse monoclonal anti-FLAG Clone M2 | Sigma-Aldrich | Cat#F1804; RRID: AB_262044 | | Rabbit polyclonal anti-beta-Actin | Cell Signaling Technology | Cat#4967; RRID: AB_330288 | | Mouse monoclonal anti-MUC2 | Novus Biologicals | Cat#NB120-11197; RRID: AB_791261 | | Rabbit polyclonal anti-Mucin2 | Santa Cruz Biotechnology | Cat#sc-15334; RRID: AB_2146667 | | Alexa Fluor® 488 Mouse anti-E-Cadherin | BD Biosciences | Cat#560061; RRID: AB_1645347 | | BD Horizon™ BV421 Mouse Anti-E-Cadherin | BD Biosciences | Cat#564186 | | Goat polyclonal anti-ACE-2 | R&D Systems | Cat#AF933; RRID: AB_355722 | | Goat polyclonal antibody to tdTomato red fluorescent protein | biorbyt | Cat#orb182397 | | Rabbit monoclonal anti-Cleaved Caspase-3 Asp175 5A1E | Cell Signaling Technology | Cat#9664; RRID: AB_2070042 | | Rabbit monoclonal anti-Olfm4 Clone D6Y5A | Cell Signaling Technology | Cat#39141; RRID: AB_2650511 | | Donkey anti-Rabbit IgG H+L Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 568 | Invitrogen | Cat#A10042; RRID: AB_2534017 | | Donkey anti-Goat IgG H+L Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 647 | Invitrogen | Cat#A21447; RRID: AB_2535864 | | Donkey anti-Mouse IgG H+L Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488 | Invitrogen | Cat#A21202; RRID: AB_141607 | | Donkey anti-Rat IgG H+L Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 594 | Invitrogen | Cat#A21209 | | Alexa Fluor® 647 AffiniPure Fab Fragment Donkey Anti-Rat IgG H+L | Jackson ImmunoResearch Labs | Cat#712-606-150; RRID: AB_2340695 | | Alexa Fluor® 488 AffiniPure Fab Fragment Donkey Anti-Chicken IgY IgG H+L | Jackson ImmunoResearch Labs | Cat#703-546-155; RRID: AB_2340376 | | Donkey anti-Mouse IgG IRDye® 800CW | LI-COR Biosciences | Cat#926-32212 | | Donkey anti-Rabbit IgG IRDye® 680CW | LI-COR Biosciences | Cat#926-68073 | | Bacterial and virus strains |
|---|
| NEB 10-beta Competent E. coli High Efficiency | New England Biolabs | Cat#C3019H | | FLAG-Fgfbp1-expressing lentivirus | This paper | N/A | | Chemicals, peptides, and recombinant proteins |
|---|
| Tamoxifen | Sigma-Aldrich | Cat#T5648; CAS: 10540-29-1 | | Diphtheria Toxin from Corynebacterium Diphtheriae | Sigma-Aldrich | Cat#D0564-1MG | | Advanced DMEM/F-12 ADMEM/F-12 | Gibco | Cat#12634-010 | | Advanced DMEM ADMEM | Gibco | Cat#12491-015 | | IMDM | Gibco | Cat#12440-053 | | DMEM | Gibco | Cat#11995-065 | | Puromycin | Sigma-Aldrich | Cat#P8833; CAS: 58-58-2 | | Matrigel | Corning | Cat#356231 | | N-2 Supplement 100X | Gibco | Cat#17502-048 | | B-27 Supplement 50X | Gibco | Cat#17504-044 | | EGF | PeproTech | Cat#AF-100-15 | | CHIR99021 | Sigma-Aldrich | Cat#SML1046; CAS:
252917-06-9 | | Collagenase/Dispase | Sigma-Aldrich | Cat#10269638001 | | Rho Kinase inhibitor | Tocris | Cat#1254 | | Lipofectamine 3000 Transfection Reagent | Invitrogen | Cat#L3000001 | | HistoDenz1.46 | Sigma-Aldrich | Cat#D2158; CAS: 66108-95-0 | | Phytagel/HD1.46 | Sigma-Aldrich | Cat#P8169; CAS: 71010-52-1 | | Antigen Unmasking Solution, Citric Acid Based | Vector Laboratories | Cat#H-3300 | | Vectashield Plus Antifade Mounting Medium | Vector Laboratories | Cat#H-1900 | | Ready Probes Mouse on Mouse IgG Blocking Solution | Invitrogen | Cat#R37621 | | Fetal Bovine Serum | R&D Systems | Cat#S11150 | | Normal Donkey Serum | Jackson ImmunoResearch Labs | Cat#017-000-121 | | DAPI | Roche | Cat#10236276001 | | SYTOX™ Blue Dead Cell Stain | Invitrogen | Cat#S34857 | | 10% Neutral Buffered Formalin | VWR | Cat#89370-094 | | Paraformaldehyde PFA | Electron Microscopy Sciences | Cat#15714-S | | Tissue-Tek O.C.T. Compound | Sakura Finetek | Cat#4583 | | Primocin | InvivoGen | Cat#ant-pm-05 | | Penicillin-Streptomycin-Glutamine PSQ 100x | Gibco | Cat#10378-016 | | Penicillin-Streptomycin | Gibco | Cat#15140-122 | | 100X Non-Essential Amino Acids | MP Biomedicals, LLC | Cat#1681049 | | PBS, 1X | Corning | Cat#21-040-CM | | Tween 20 | Fisher Scientific | Cat#BP337-500; CAS: 9005-64-5 | | Triton X-100 | Sigma | Cat#T8787; CAS: 9002-93-1 | | HEPES 1M | Gibco | Cat#15630-080 | | UltraPure 0.5 M EDTA, pH 8.0 | Invitrogen | Cat#15575-038 | | GlutaMAX-I 100X | Gibco | Cat#35050-061 | | TrypLE Express | Gibco | Cat#12604-013 | | 10x Tris/Glycine/SDS Buffer | Bio-Rad | Cat#1610732 | | 10x Tris/Glycine Buffer | Bio-Rad | Cat#1610734 | | PageRuler Prestained Protein Ladder | Thermo Scientific | Cat#26616 | | RIPA Lysis and Extraction Buffer | Thermo Scientific | Cat#89900 | | cOmplete™ Protease Inhibitor Cocktail | Millipore Sigma | Cat#4693116001 | | Sodium Dodecyl Sulfate | Sigma-Aldrich | Cat#71725-50G; CAS: 151-21-3 | | Restriction endonucleases various | New England Biolabs | N/A | | Critical commercial assays |
|---|
| RNeasy Mini Kit | Qiagen | Cat#74106 | | Phusion ® High-Fidelity DNA Polymerase | New England Biolabs | Cat#M0530L | | ZymoPURE Plasmid Miniprep Kit | Zymo Research | Cat#D4211 | | ZymoPURE II Plasmid Midiprep Kit | Zymo Research | Cat#D4201 | | Zymoclean Gel DNA Recovery Kit | Zymo Research | Cat#D4002 | | DNA Clean & Concentrator-5 | Zymo Research | Cat#4004 | | NEBuilder ® HiFi DNA Assembly Master Mix | New England Biolabs | Cat#E2621L | | T4 DNA Ligase | New England Biolabs | Cat#M0202S | | Anti-Flag ® M2 Magnetic Beads | Millipore Sigma | Cat#M8823-1ML | | RNAScope ® Multiplex Fluorescent Reagent Kit v2 | Advanced Cell Diagnostics | Cat#323100 | | RNA-Protein Co-Detection Ancillary Kit | Advanced Cell Diagnostics | Cat#323180 | | RNAScope ® 4-Plex Ancillary Kit for Multiplex Fluorescent Reagent Kit v2 | Advanced Cell Diagnostics | Cat#323120 | | Deposited data |
|---|
| Single-Cell RNA-seq of intestinal epithelial cells upon Wnt/Rspo pharmacological modulation | Yan et al.31 | GEO accession: GSE92865 | | Single-Cell RNA-seq of intestinal epithelial cells unperturbed | Haber et al.34 | GEO accession: GSE92332 | | Single-Cell RNA-seq of intestinal epithelial cells unperturbed, enriched for secretory cell types | Böttcher et al.37 | GEO accession: GSE152325 | | Experimental models: Cell lines |
|---|
| HEK293T 293T | ATCC | Cat#CRL-3216; RRID: CVCL_0063 | | Wnt3A/RSPO1/Noggin expressing cells L-WRN | ATCC | Cat#CRL-3276; RRID: DA06 | | KV1 129S6_C57BL/6N Hybrid | Dr. Chyuan-Sheng Lin, Columbia University | N/A | | Experimental models: Organisms/strains |
|---|
| Mouse: Lgr5-eGFP-IRES-CreERT2: B6.129P2-Lgr5tm1cre/ERT2Cle/J | The Jackson Laboratory | JAX: 008875; RRID: IMSR_JAX:008875 | | Mouse: Villin-CreERT2: B6.Cg-TgVil1-cre/ERT223Syr/J | The Jackson Laboratory | JAX: 020282; RRID: IMSR_JAX:020282 | | Mouse: Lgr5-DTR-GFP | Dr. Frederic de Sauvage, Genentech | N/A | | Mouse: Fgfbp1-CreERT2 | This paper | N/A | | Mouse: Fgfbp1-TimeR | This paper | N/A | | Mouse: Rosa26-CreERT2: GtROSA26Sortm1cre/ERT2Ty/J | The Jackson Laboratory | JAX: 008463; RRID: IMSR_JAX:008463 | | Mouse: Rosa26-Confetti: B6.129P2-GtROSA26Sortm1CAG-Brainbow2.1Cle/J | The Jackson Laboratory | JAX: 017492; RRID: IMSR_JAX:017492 | | Mouse: Rosa26-tdTomato: B6.Cg-GtROSA26Sortm14CAG-tdTomatoHze/J | The Jackson Laboratory | JAX: 007914; RRID: IMSR_JAX:005703 | | Mouse: Actin-Flpe: TgACTFLPe9205Dym | The Jackson Laboratory | JAX: 005703; RRID: IMSR_JAX:005703 | | Oligonucleotides |
|---|
| RNAscope ® Mm Lgr5 probe | Advanced Cell Diagnostics | Cat#312171 | | RNAscope ® Mm Fgfbp1 probe | Advanced Cell Diagnostics | Cat#508831-C4 | | RNAscope ® Mm Dmbt1 probe | Advanced Cell Diagnostics | Cat#418561-C2 | | Recombinant DNA |
|---|
| pMCS-DT.A | Dr. Kosuke Yusa, Osaka University, Japan | N/A | | pCS2+ | RZPD | N/A | | pLenti CMV GFP Puro 658-5 | Campeau et al.73 | Addgene: Plasmid #17448 | | pMD2.G | Didier Trono lab | Addgene: Plasmid #12259 | | psPAX2 | Didier Trono lab | Addgene: Plasmid #12260 | | FLAG-Fgfbp1 lentiviral expression plasmid | This paper | N/A | | DsRedE2-PEST expression plasmid | This paper | N/A | | 1xUbVR-DsRedE2-PEST expression plasmid | This paper | N/A | | Software and algorithms |
|---|
| FlowJo V10.8.1 | BD Biosciences | https://www.flowjo.com/ | | Leica Application Suite X LAS X | Leica Microsystems | https://www.leica-microsystems.com/products/microscope-software/p/leica-las-x-ls/ | | Zen blue 3.5 ZEISS ZEN lite | Carl Zeiss Microscopy | https://www.zeiss.com/microscopy/en/products/software/zeiss-zen-lite.html | | Fiji/ImageJ 2.14.0; Java1.8.0_322 | Wayne Rasband and Contributors, National Insitutes of Health, USA | https://imagej.org | | R v4.0.3 | R Core Team | https://www.r-project.org/ | | Seurat v4.2.0 | Satija Lab | https://satijalab.org/seurat/ | | Nebulosa v1.0.2 | Alquicira-Hernandez and Powell74 | https://github.com/powellgenomicslab/Nebulosa | | ggplot2 v3.3.6 | N/A | https://github.com/tidyverse/ggplot2 | | scVelo v0.2.2 | Bergen et al.35 | https://scvelo.readthedocs.io/ | | velocyto v.0.17 | Kharchenko Lab | https://velocyto.org/velocyto.py/ | | Python v3.7.7 | Python Software Foundation | https://python.org/ | | Cell Ranger v5.0.0 | 10X Genomics | N/A | | Prism v8.0.1 | GraphPad Software | https://www.graphpad.com/scientific-software/prism/ | | Other |
|---|
| Odyssey CLx Imager | LI-COR Biosciences | N/A | | Zeiss Confocal Microscope LSM 710 | Carl Zeiss Microscopy | N/A | | Leica DMi8 Stellaris confocal microscope | Leica Microsystems | N/A | | Leica DMi8 Widefield microscope | Leica Microsystems | N/A | | Leica CM3050 S Cryostat | Leica Biosystems | N/A | | Microm HM 325 Microtome | Thermo Scientific | N/A | | Superfrost Plus Microscope Slides White Tab | Fisher Scientific | Cat#1255015 | | Microscope Cover Glass | Fisher Scientific | Cat#12544D | | Novocyte Quanteon flow cytometer | Agilent | N/A | | BD FACSAria II Cell Sorter | BD Biosystems | N/A | | Amicon® Ultra-15 Centrifugal Filter Unit | Millipore | Cat#UFC910008 |
| | Time-resolved fate mapping identifies the intestinal upper crypt zone as an origin of Lgr5+ crypt base columnar cells. | Capdevila C, Miller J, Cheng L, Kornberg A, George JJ, Lee H, Botella T, Moon CS, Murray JW, Lam S, Calderon RI, Malagola E, Whelan G, Lin CS, Han A, Wang TC, Sims PA, Yan KS | 2024 Jun 6 | | 38848677 |
PMID:
38781967
Title:
Patterning and folding of intestinal villi by active mesenchymal dewetting.
Authors:
Huycke TR, Häkkinen TJ, Miyazaki H, Srivastava V, Barruet E, McGinnis CS, Kalantari A, Cornwall-Scoones J, Vaka D, Zhu Q, Jo H, Oria R, Weaver VM, DeGrado WF, Thomson M, Garikipati K, Boffelli D, Klein OD, Gartner ZJ
Journal:
Cell
Publication Date:
2024 Jun 6
DOI:
https://doi.org/10.1016/j.cell.2024.04.039
MeSH Terms: Animals, Mice, Intestinal Mucosa, Extracellular Matrix, Myosin Type II, Mesoderm, Mesenchymal Stem Cells, Receptor, Platelet-Derived Growth Factor alpha, Morphogenesis, Matrix Metalloproteinases
|
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|
| Antibodies |
|---|
| Rabbit polyclonal anti-RFP pre-adsorbed | Rockland | Cat#600-401-379; RRID: AB_2209751 | | Anti-mTagBFP2 single domain antibody | NanoTag Biotechnologies | Cat#N0502-AF647-L | | Chicken polyclonal anti-GFP | Aveslabs | Cat#GFP-1020; RRID: AB_2307313 | | Rabbit monoclonal anti-Ki67 Clone D3B5 | Cell Signaling Technology | Cat#9129; RRID: AB_2687446 | | Rat monoclonal anti-ki67 Clone SolA15 | Invitrogen | Cat#14-5698-82; RRID: AB_1085456 | | Goat polyclonal anti-CHGA | Santa Cruz Biotechnology | Cat#sc-1488; RRID: AB_2276319 | | Rabbit polyclonal anti-lysozyme1 | Agilent Dako | Cat#A0099; RRID: AB_2341230 | | Mouse monoclonal anti-lysozyme1 Clone E-5 | Santa Cruz Biotechnology | Cat#sc-27958; RRID: AB_2138790 | | Rabbit polyclonal anti-FABP1 | Novus Biologicals | Cat#NBP1-87695; RRID: AB_1102215 | | Mouse monoclonal anti-FLAG Clone M2 | Sigma-Aldrich | Cat#F1804; RRID: AB_262044 | | Rabbit polyclonal anti-beta-Actin | Cell Signaling Technology | Cat#4967; RRID: AB_330288 | | Mouse monoclonal anti-MUC2 | Novus Biologicals | Cat#NB120-11197; RRID: AB_791261 | | Rabbit polyclonal anti-Mucin2 | Santa Cruz Biotechnology | Cat#sc-15334; RRID: AB_2146667 | | Alexa Fluor® 488 Mouse anti-E-Cadherin | BD Biosciences | Cat#560061; RRID: AB_1645347 | | BD Horizon™ BV421 Mouse Anti-E-Cadherin | BD Biosciences | Cat#564186 | | Goat polyclonal anti-ACE-2 | R&D Systems | Cat#AF933; RRID: AB_355722 | | Goat polyclonal antibody to tdTomato red fluorescent protein | biorbyt | Cat#orb182397 | | Rabbit monoclonal anti-Cleaved Caspase-3 Asp175 5A1E | Cell Signaling Technology | Cat#9664; RRID: AB_2070042 | | Rabbit monoclonal anti-Olfm4 Clone D6Y5A | Cell Signaling Technology | Cat#39141; RRID: AB_2650511 | | Donkey anti-Rabbit IgG H+L Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 568 | Invitrogen | Cat#A10042; RRID: AB_2534017 | | Donkey anti-Goat IgG H+L Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 647 | Invitrogen | Cat#A21447; RRID: AB_2535864 | | Donkey anti-Mouse IgG H+L Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488 | Invitrogen | Cat#A21202; RRID: AB_141607 | | Donkey anti-Rat IgG H+L Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 594 | Invitrogen | Cat#A21209 | | Alexa Fluor® 647 AffiniPure Fab Fragment Donkey Anti-Rat IgG H+L | Jackson ImmunoResearch Labs | Cat#712-606-150; RRID: AB_2340695 | | Alexa Fluor® 488 AffiniPure Fab Fragment Donkey Anti-Chicken IgY IgG H+L | Jackson ImmunoResearch Labs | Cat#703-546-155; RRID: AB_2340376 | | Donkey anti-Mouse IgG IRDye® 800CW | LI-COR Biosciences | Cat#926-32212 | | Donkey anti-Rabbit IgG IRDye® 680CW | LI-COR Biosciences | Cat#926-68073 | | Bacterial and virus strains |
|---|
| NEB 10-beta Competent E. coli High Efficiency | New England Biolabs | Cat#C3019H | | FLAG-Fgfbp1-expressing lentivirus | This paper | N/A | | Chemicals, peptides, and recombinant proteins |
|---|
| Tamoxifen | Sigma-Aldrich | Cat#T5648; CAS: 10540-29-1 | | Diphtheria Toxin from Corynebacterium Diphtheriae | Sigma-Aldrich | Cat#D0564-1MG | | Advanced DMEM/F-12 ADMEM/F-12 | Gibco | Cat#12634-010 | | Advanced DMEM ADMEM | Gibco | Cat#12491-015 | | IMDM | Gibco | Cat#12440-053 | | DMEM | Gibco | Cat#11995-065 | | Puromycin | Sigma-Aldrich | Cat#P8833; CAS: 58-58-2 | | Matrigel | Corning | Cat#356231 | | N-2 Supplement 100X | Gibco | Cat#17502-048 | | B-27 Supplement 50X | Gibco | Cat#17504-044 | | EGF | PeproTech | Cat#AF-100-15 | | CHIR99021 | Sigma-Aldrich | Cat#SML1046; CAS:
252917-06-9 | | Collagenase/Dispase | Sigma-Aldrich | Cat#10269638001 | | Rho Kinase inhibitor | Tocris | Cat#1254 | | Lipofectamine 3000 Transfection Reagent | Invitrogen | Cat#L3000001 | | HistoDenz1.46 | Sigma-Aldrich | Cat#D2158; CAS: 66108-95-0 | | Phytagel/HD1.46 | Sigma-Aldrich | Cat#P8169; CAS: 71010-52-1 | | Antigen Unmasking Solution, Citric Acid Based | Vector Laboratories | Cat#H-3300 | | Vectashield Plus Antifade Mounting Medium | Vector Laboratories | Cat#H-1900 | | Ready Probes Mouse on Mouse IgG Blocking Solution | Invitrogen | Cat#R37621 | | Fetal Bovine Serum | R&D Systems | Cat#S11150 | | Normal Donkey Serum | Jackson ImmunoResearch Labs | Cat#017-000-121 | | DAPI | Roche | Cat#10236276001 | | SYTOX™ Blue Dead Cell Stain | Invitrogen | Cat#S34857 | | 10% Neutral Buffered Formalin | VWR | Cat#89370-094 | | Paraformaldehyde PFA | Electron Microscopy Sciences | Cat#15714-S | | Tissue-Tek O.C.T. Compound | Sakura Finetek | Cat#4583 | | Primocin | InvivoGen | Cat#ant-pm-05 | | Penicillin-Streptomycin-Glutamine PSQ 100x | Gibco | Cat#10378-016 | | Penicillin-Streptomycin | Gibco | Cat#15140-122 | | 100X Non-Essential Amino Acids | MP Biomedicals, LLC | Cat#1681049 | | PBS, 1X | Corning | Cat#21-040-CM | | Tween 20 | Fisher Scientific | Cat#BP337-500; CAS: 9005-64-5 | | Triton X-100 | Sigma | Cat#T8787; CAS: 9002-93-1 | | HEPES 1M | Gibco | Cat#15630-080 | | UltraPure 0.5 M EDTA, pH 8.0 | Invitrogen | Cat#15575-038 | | GlutaMAX-I 100X | Gibco | Cat#35050-061 | | TrypLE Express | Gibco | Cat#12604-013 | | 10x Tris/Glycine/SDS Buffer | Bio-Rad | Cat#1610732 | | 10x Tris/Glycine Buffer | Bio-Rad | Cat#1610734 | | PageRuler Prestained Protein Ladder | Thermo Scientific | Cat#26616 | | RIPA Lysis and Extraction Buffer | Thermo Scientific | Cat#89900 | | cOmplete™ Protease Inhibitor Cocktail | Millipore Sigma | Cat#4693116001 | | Sodium Dodecyl Sulfate | Sigma-Aldrich | Cat#71725-50G; CAS: 151-21-3 | | Restriction endonucleases various | New England Biolabs | N/A | | Critical commercial assays |
|---|
| RNeasy Mini Kit | Qiagen | Cat#74106 | | Phusion ® High-Fidelity DNA Polymerase | New England Biolabs | Cat#M0530L | | ZymoPURE Plasmid Miniprep Kit | Zymo Research | Cat#D4211 | | ZymoPURE II Plasmid Midiprep Kit | Zymo Research | Cat#D4201 | | Zymoclean Gel DNA Recovery Kit | Zymo Research | Cat#D4002 | | DNA Clean & Concentrator-5 | Zymo Research | Cat#4004 | | NEBuilder ® HiFi DNA Assembly Master Mix | New England Biolabs | Cat#E2621L | | T4 DNA Ligase | New England Biolabs | Cat#M0202S | | Anti-Flag ® M2 Magnetic Beads | Millipore Sigma | Cat#M8823-1ML | | RNAScope ® Multiplex Fluorescent Reagent Kit v2 | Advanced Cell Diagnostics | Cat#323100 | | RNA-Protein Co-Detection Ancillary Kit | Advanced Cell Diagnostics | Cat#323180 | | RNAScope ® 4-Plex Ancillary Kit for Multiplex Fluorescent Reagent Kit v2 | Advanced Cell Diagnostics | Cat#323120 | | Deposited data |
|---|
| Single-Cell RNA-seq of intestinal epithelial cells upon Wnt/Rspo pharmacological modulation | Yan et al.31 | GEO accession: GSE92865 | | Single-Cell RNA-seq of intestinal epithelial cells unperturbed | Haber et al.34 | GEO accession: GSE92332 | | Single-Cell RNA-seq of intestinal epithelial cells unperturbed, enriched for secretory cell types | Böttcher et al.37 | GEO accession: GSE152325 | | Experimental models: Cell lines |
|---|
| HEK293T 293T | ATCC | Cat#CRL-3216; RRID: CVCL_0063 | | Wnt3A/RSPO1/Noggin expressing cells L-WRN | ATCC | Cat#CRL-3276; RRID: DA06 | | KV1 129S6_C57BL/6N Hybrid | Dr. Chyuan-Sheng Lin, Columbia University | N/A | | Experimental models: Organisms/strains |
|---|
| Mouse: Lgr5-eGFP-IRES-CreERT2: B6.129P2-Lgr5tm1cre/ERT2Cle/J | The Jackson Laboratory | JAX: 008875; RRID: IMSR_JAX:008875 | | Mouse: Villin-CreERT2: B6.Cg-TgVil1-cre/ERT223Syr/J | The Jackson Laboratory | JAX: 020282; RRID: IMSR_JAX:020282 | | Mouse: Lgr5-DTR-GFP | Dr. Frederic de Sauvage, Genentech | N/A | | Mouse: Fgfbp1-CreERT2 | This paper | N/A | | Mouse: Fgfbp1-TimeR | This paper | N/A | | Mouse: Rosa26-CreERT2: GtROSA26Sortm1cre/ERT2Ty/J | The Jackson Laboratory | JAX: 008463; RRID: IMSR_JAX:008463 | | Mouse: Rosa26-Confetti: B6.129P2-GtROSA26Sortm1CAG-Brainbow2.1Cle/J | The Jackson Laboratory | JAX: 017492; RRID: IMSR_JAX:017492 | | Mouse: Rosa26-tdTomato: B6.Cg-GtROSA26Sortm14CAG-tdTomatoHze/J | The Jackson Laboratory | JAX: 007914; RRID: IMSR_JAX:005703 | | Mouse: Actin-Flpe: TgACTFLPe9205Dym | The Jackson Laboratory | JAX: 005703; RRID: IMSR_JAX:005703 | | Oligonucleotides |
|---|
| RNAscope ® Mm Lgr5 probe | Advanced Cell Diagnostics | Cat#312171 | | RNAscope ® Mm Fgfbp1 probe | Advanced Cell Diagnostics | Cat#508831-C4 | | RNAscope ® Mm Dmbt1 probe | Advanced Cell Diagnostics | Cat#418561-C2 | | Recombinant DNA |
|---|
| pMCS-DT.A | Dr. Kosuke Yusa, Osaka University, Japan | N/A | | pCS2+ | RZPD | N/A | | pLenti CMV GFP Puro 658-5 | Campeau et al.73 | Addgene: Plasmid #17448 | | pMD2.G | Didier Trono lab | Addgene: Plasmid #12259 | | psPAX2 | Didier Trono lab | Addgene: Plasmid #12260 | | FLAG-Fgfbp1 lentiviral expression plasmid | This paper | N/A | | DsRedE2-PEST expression plasmid | This paper | N/A | | 1xUbVR-DsRedE2-PEST expression plasmid | This paper | N/A | | Software and algorithms |
|---|
| FlowJo V10.8.1 | BD Biosciences | https://www.flowjo.com/ | | Leica Application Suite X LAS X | Leica Microsystems | https://www.leica-microsystems.com/products/microscope-software/p/leica-las-x-ls/ | | Zen blue 3.5 ZEISS ZEN lite | Carl Zeiss Microscopy | https://www.zeiss.com/microscopy/en/products/software/zeiss-zen-lite.html | | Fiji/ImageJ 2.14.0; Java1.8.0_322 | Wayne Rasband and Contributors, National Insitutes of Health, USA | https://imagej.org | | R v4.0.3 | R Core Team | https://www.r-project.org/ | | Seurat v4.2.0 | Satija Lab | https://satijalab.org/seurat/ | | Nebulosa v1.0.2 | Alquicira-Hernandez and Powell74 | https://github.com/powellgenomicslab/Nebulosa | | ggplot2 v3.3.6 | N/A | https://github.com/tidyverse/ggplot2 | | scVelo v0.2.2 | Bergen et al.35 | https://scvelo.readthedocs.io/ | | velocyto v.0.17 | Kharchenko Lab | https://velocyto.org/velocyto.py/ | | Python v3.7.7 | Python Software Foundation | https://python.org/ | | Cell Ranger v5.0.0 | 10X Genomics | N/A | | Prism v8.0.1 | GraphPad Software | https://www.graphpad.com/scientific-software/prism/ | | Other |
|---|
| Odyssey CLx Imager | LI-COR Biosciences | N/A | | Zeiss Confocal Microscope LSM 710 | Carl Zeiss Microscopy | N/A | | Leica DMi8 Stellaris confocal microscope | Leica Microsystems | N/A | | Leica DMi8 Widefield microscope | Leica Microsystems | N/A | | Leica CM3050 S Cryostat | Leica Biosystems | N/A | | Microm HM 325 Microtome | Thermo Scientific | N/A | | Superfrost Plus Microscope Slides White Tab | Fisher Scientific | Cat#1255015 | | Microscope Cover Glass | Fisher Scientific | Cat#12544D | | Novocyte Quanteon flow cytometer | Agilent | N/A | | BD FACSAria II Cell Sorter | BD Biosystems | N/A | | Amicon® Ultra-15 Centrifugal Filter Unit | Millipore | Cat#UFC910008 |
| | Patterning and folding of intestinal villi by active mesenchymal dewetting. | Huycke TR, Häkkinen TJ, Miyazaki H, Srivastava V, Barruet E, McGinnis CS, Kalantari A, Cornwall-Scoones J, Vaka D, Zhu Q, Jo H, Oria R, Weaver VM, DeGrado WF, Thomson M, Garikipati K, Boffelli D, Klein OD, Gartner ZJ | 2024 Jun 6 | | 38781967 |
PMID:
38848678
Title:
Isthmus progenitor cells contribute to homeostatic cellular turnover and support regeneration following intestinal injury.
Authors:
Malagola E, Vasciaveo A, Ochiai Y, Kim W, Zheng B, Zanella L, Wang ALE, Middelhoff M, Nienhüser H, Deng L, Wu F, Waterbury QT, Belin B, LaBella J, Zamechek LB, Wong MH, Li L, Guha C, Cheng CW, Yan KS, Califano A, Wang TC
Journal:
Cell
Publication Date:
2024 Jun 6
DOI:
https://doi.org/10.1016/j.cell.2024.05.004
MeSH Terms: Animals, Regeneration, Stem Cells, Homeostasis, Mice, Intestinal Mucosa, Receptors, G-Protein-Coupled, Intestines, Cell Differentiation, Mice, Inbred C57BL, Epithelial Cells, Single-Cell Analysis, Male
|
| | Isthmus progenitor cells contribute to homeostatic cellular turnover and support regeneration following intestinal injury. | Malagola E, Vasciaveo A, Ochiai Y, Kim W, Zheng B, Zanella L, Wang ALE, Middelhoff M, Nienhüser H, Deng L, Wu F, Waterbury QT, Belin B, LaBella J, Zamechek LB, Wong MH, Li L, Guha C, Cheng CW, Yan KS, Califano A, Wang TC | 2024 Jun 6 | | 38848678 |
PMID:
38682276
Title:
GPR124 regulates murine brain embryonic angiogenesis and BBB formation by an intracellular domain-independent mechanism.
Authors:
Yuki K, Vallon M, Ding J, Rada CC, Tang AT, Vilches-Moure JG, McCormick AK, Henao Echeverri MF, Alwahabi S, Braunger BM, Ergün S, Kahn ML, Kuo CJ
Journal:
Development
Publication Date:
2024 Jun 1
DOI:
https://doi.org/10.1242/dev.202794
MeSH Terms: Animals, Blood-Brain Barrier, Neovascularization, Physiologic, Receptors, G-Protein-Coupled, Mice, Brain, Protein Domains, Mice, Knockout, Signal Transduction, Wnt Proteins, Humans, Endothelial Cells, Angiogenesis, GPI-Linked Proteins
|
The raw and processed RNA-seq data have been deposited in GEO under accession number GSE225367.
| True | GPR124 regulates murine brain embryonic angiogenesis and BBB formation by an intracellular domain-independent mechanism. | Yuki K, Vallon M, Ding J, Rada CC, Tang AT, Vilches-Moure JG, McCormick AK, Henao Echeverri MF, Alwahabi S, Braunger BM, Ergün S, Kahn ML, Kuo CJ | 2024 Jun 1 | | 38682276 |
PMID:
37205513
Title:
Key role of down-regulated in adenoma (SLC26A3) chloride/bicarbonate exchanger in linaclotide-stimulated intestinal bicarbonate secretion upon loss of CFTR function.
Authors:
Sarthi JB, Trumbull AM, Abazari SM, van Unen V, Chan JE, Jiang Y, Gammons J, Anderson MO, Cil O, Kuo CJ, Sellers ZM
Journal:
bioRxiv
Publication Date:
2024 Apr 22
DOI:
https://doi.org/10.1101/2023.05.05.539132
MeSH Terms: No Mesh Terms available
|
The authors declare that the data supporting the findings of this study are available within the
paper and its supplementary information files. Any further information on the data in this study
are available by reasonable request to the corresponding author.
| True | Key role of down-regulated in adenoma (SLC26A3) chloride/bicarbonate exchanger in linaclotide-stimulated intestinal bicarbonate secretion upon loss of CFTR function. | Sarthi JB, Trumbull AM, Abazari SM, van Unen V, Chan JE, Jiang Y, Gammons J, Anderson MO, Cil O, Kuo CJ, Sellers ZM | 2024 Apr 22 | | 37205513 |
PMID:
38349111
Title:
Mechanisms driving fasting-induced protection from genotoxic injury in the small intestine.
Authors:
Deans-Fielder K, Wu T, Nguyen T, To S, Huang YZ, Bark SJ, Mills JC, Shroyer NF
Journal:
Am J Physiol Gastrointest Liver Physiol
Publication Date:
2024 May 1
DOI:
https://doi.org/10.1152/ajpgi.00126.2023
MeSH Terms: Mice, Animals, Intestine, Small, Intestines, Mechanistic Target of Rapamycin Complex 1, DNA Adducts, Fasting, Doxorubicin
|
Source data for this study are openly available at GEO, accession: GSE245477.
| | Mechanisms driving fasting-induced protection from genotoxic injury in the small intestine. | Deans-Fielder K, Wu T, Nguyen T, To S, Huang YZ, Bark SJ, Mills JC, Shroyer NF | 2024 May 1 | | 38349111 |
PMID:
38321203
Title:
Epithelial zonation along the mouse and human small intestine defines five discrete metabolic domains.
Authors:
Zwick RK, Kasparek P, Palikuqi B, Viragova S, Weichselbaum L, McGinnis CS, McKinley KL, Rathnayake A, Vaka D, Nguyen V, Trentesaux C, Reyes E, Gupta AR, Gartner ZJ, Locksley RM, Gardner JM, Itzkovitz S, Boffelli D, Klein OD
Journal:
Nat Cell Biol
Publication Date:
2024 Feb
DOI:
https://doi.org/10.1038/s41556-023-01337-z
MeSH Terms: Humans, Mice, Animals, Intestine, Small, Duodenum, Intestines, Jejunum, Ileum, Mammals
|
The datasets generated and analysed in the current study are available in the Gene Expression Omnibus (GEO; BioProject accession code GSE201859) and can be visualized using the Chan Zuckerberg CELLxGENE tool (https://cellxgene.cziscience.com/collections/3db5617e-9f12-4eb4-8416-94893a0d7c46). Previously published single-cell sequencing data6 analysed here are available under accession code GSE92332. Source data and analysis outputs are provided in the Supplementary Information associated with this publication. All other data supporting the findings of this study are available from the corresponding author on reasonable request.
Custom code developed for this manuscript is available in Zenodo under record no. 10223562.
| | Epithelial zonation along the mouse and human small intestine defines five discrete metabolic domains. | Zwick RK, Kasparek P, Palikuqi B, Viragova S, Weichselbaum L, McGinnis CS, McKinley KL, Rathnayake A, Vaka D, Nguyen V, Trentesaux C, Reyes E, Gupta AR, Gartner ZJ, Locksley RM, Gardner JM, Itzkovitz S, Boffelli D, Klein OD | 2024 Feb | | 38321203 |
PMID:
38337789
Title:
Near-Infrared In Vivo Imaging of Claudin-1 Expression by Orthotopically Implanted Patient-Derived Colonic Adenoma Organoids.
Authors:
Jaiswal S, Wang F, Wu X, Chang TS, Shirazi A, Lee M, Dame MK, Spence JR, Wang TD
Journal:
Diagnostics (Basel)
Publication Date:
2024 Jan 26
DOI:
https://doi.org/10.3390/diagnostics14030273
MeSH Terms: No Mesh Terms available
|
The reported data, including the Supplementary Materials, are available
from the corresponding authors upon request.
| True | Near-Infrared In Vivo Imaging of Claudin-1 Expression by Orthotopically Implanted Patient-Derived Colonic Adenoma Organoids. | Jaiswal S, Wang F, Wu X, Chang TS, Shirazi A, Lee M, Dame MK, Spence JR, Wang TD | 2024 Jan 26 | | 38337789 |
PMID:
38291503
Title:
deMULTIplex2: robust sample demultiplexing for scRNA-seq.
Authors:
Zhu Q, Conrad DN, Gartner ZJ
Journal:
Genome Biol
Publication Date:
2024 Jan 30
DOI:
https://doi.org/10.1186/s13059-024-03177-y
MeSH Terms: Single-Cell Gene Expression Analysis, Single-Cell Analysis, Algorithms, Sequence Analysis, RNA, High-Throughput Nucleotide Sequencing
|
| True | deMULTIplex2: robust sample demultiplexing for scRNA-seq. | Zhu Q, Conrad DN, Gartner ZJ | 2024 Jan 30 | | 38291503 |
PMID:
38042929
Title:
Role of PDGFRA(+) cells and a CD55(+) PDGFRA(Lo) fraction in the gastric mesenchymal niche.
Authors:
Manieri E, Tie G, Malagola E, Seruggia D, Madha S, Maglieri A, Huang K, Fujiwara Y, Zhang K, Orkin SH, Wang TC, He R, McCarthy N, Shivdasani RA
Journal:
Nat Commun
Publication Date:
2023 Dec 2
DOI:
https://doi.org/10.1038/s41467-023-43619-y
MeSH Terms: Mice, Animals, Stomach, Gastric Mucosa, Stem Cells, Intestines, Pyloric Antrum, Receptor Protein-Tyrosine Kinases, Epithelial Cells
|
The sequencing data generated in this study have been deposited in
the Gene Expression Omnibus (GEO) repository under accession code
GSE224737. This study includes analysis of previously published data,
referenced with GEO accession number GSE130681, ArrayExpress
accession numbers E-MTAB-6879, and
NCBI Sequence Read Archive SRP227356 . Any additional information required to reanalyze data reported in this paper is available from the corresponding author upon request. Source data are provided with this paper.
| True | Role of PDGFRA(+) cells and a CD55(+) PDGFRA(Lo) fraction in the gastric mesenchymal niche. | Manieri E, Tie G, Malagola E, Seruggia D, Madha S, Maglieri A, Huang K, Fujiwara Y, Zhang K, Orkin SH, Wang TC, He R, McCarthy N, Shivdasani RA | 2023 Dec 2 | | 38042929 |
PMID:
37865088
Title:
TGFB1 induces fetal reprogramming and enhances intestinal regeneration.
Authors:
Chen L, Qiu X, Dupre A, Pellon-Cardenas O, Fan X, Xu X, Rout P, Walton KD, Burclaff J, Zhang R, Fang W, Ofer R, Logerfo A, Vemuri K, Bandyopadhyay S, Wang J, Barbet G, Wang Y, Gao N, Perekatt AO, Hu W, Magness ST, Spence JR, Verzi MP
Journal:
Cell Stem Cell
Publication Date:
2023 Nov 2
DOI:
https://doi.org/10.1016/j.stem.2023.09.015
MeSH Terms: Animals, Humans, Mice, Colon, Intestinal Mucosa, Intestines, Organoids, Signal Transduction, Transforming Growth Factor beta1
|
Single-cell RNA-seq, RNA-seq and ATAC-seq data have been deposited at GEO and are publicly available as of the date of publication. Accession numbers are listed in the key resources table. This paper analyzes existing, publicly available data. These accession numbers for the datasets are listed in the key resources table. This paper does not report original code.
RNA-seq, scRNA-seq and ATAC-seq data: GSE222505
RNA-seq of crypts upon IR: Qu et al., 2021, GSE165157
scRNA-seq of normal crypts and irradiated crypts: Ayyaz et al., 2019, GSE117783
scRNA-seq of duodenum/jejunum boundary samples upon IR: GSE165318
scRNA-seq of sorted Msi1-GFP positive cells (irradiation-resistant) and their progeny cells upon IR: Sheng et al., 2020, GSE145866
SMAD4 ChIP in mouse intestinal epithelium: Chen et al., 2019, GSE112946
Any additional information required to reanalyze the data reported in this work paper is available from the lead contact upon request.
| | TGFB1 induces fetal reprogramming and enhances intestinal regeneration. | Chen L, Qiu X, Dupre A, Pellon-Cardenas O, Fan X, Xu X, Rout P, Walton KD, Burclaff J, Zhang R, Fang W, Ofer R, Logerfo A, Vemuri K, Bandyopadhyay S, Wang J, Barbet G, Wang Y, Gao N, Perekatt AO, Hu W, Magness ST, Spence JR, Verzi MP | 2023 Nov 2 | | 37865088 |
PMID:
37922878
Title:
Development of functional resident macrophages in human pluripotent stem cell-derived colonic organoids and human fetal colon.
Authors:
Múnera JO, Kechele DO, Bouffi C, Qu N, Jing R, Maity P, Enriquez JR, Han L, Campbell I, Mahe MM, McCauley HA, Zhang X, Sundaram N, Hudson JR, Zarsozo-Lacoste A, Pradhan S, Tominaga K, Sanchez JG, Weiss AA, Chatuvedi P, Spence JR, Hachimi M, North T, Daley GQ, Mayhew CN, Hu YC, Takebe T, Helmrath MA, Wells JM
Journal:
Cell Stem Cell
Publication Date:
2023 Nov 2
DOI:
https://doi.org/10.1016/j.stem.2023.10.002
MeSH Terms: Humans, Mice, Animals, Pluripotent Stem Cells, Hematopoietic Stem Cells, Colon, Organoids, Macrophages
|
Bulk RNA-seq and scRNA-seq datasets generated in this study are publicly available in NCBI’s Gene Expression Omnibus (GEO): GSE240363. All accession numbers used in this study are listed in the key resources table. All scRNA-seq analysis was performed in R using previously generated codes, which are referenced in the key resource table. This paper does not report original code. Additional information, original images, digital scans of cytospins, or scripts needed for further analysis are available upon request.
| | Development of functional resident macrophages in human pluripotent stem cell-derived colonic organoids and human fetal colon. | Múnera JO, Kechele DO, Bouffi C, Qu N, Jing R, Maity P, Enriquez JR, Han L, Campbell I, Mahe MM, McCauley HA, Zhang X, Sundaram N, Hudson JR, Zarsozo-Lacoste A, Pradhan S, Tominaga K, Sanchez JG, Weiss AA, Chatuvedi P, Spence JR, Hachimi M, North T, Daley GQ, Mayhew CN, Hu YC, Takebe T, Helmrath MA, Wells JM | 2023 Nov 2 | | 37922878 |
PMID:
37909332
Title:
Human intestinal organoids from Cronkhite-Canada syndrome patients reveal link between serotonin and proliferation.
Authors:
Poplaski V, Bomidi C, Kambal A, Nguyen-Phuc H, Di Rienzi SC, Danhof HA, Zeng XL, Feagins LA, Deng N, Vilar E, McAllister F, Coarfa C, Min S, Kim HJ, Shukla R, Britton R, Estes MK, Blutt SE
Journal:
J Clin Invest
Publication Date:
2023 Nov 1
DOI:
https://doi.org/10.1172/JCI166884
MeSH Terms: Humans, Serotonin, Intestines, Organoids, Colorectal Neoplasms, Intestinal Polyposis
|
The RNA-Seq data generated in this study are deposited in the Gene Expression Omnibus database: CCS and Non-CCS HIOs, GSE207838; NGN3 HIOs, GSE138350; and FAP and Healthy Patients, GSE153385, GSE156172, GSE106500. Codes are available from the corresponding author upon request. Raw data is available in an associated Supporting Data Values file
| True | Human intestinal organoids from Cronkhite-Canada syndrome patients reveal link between serotonin and proliferation. | Poplaski V, Bomidi C, Kambal A, Nguyen-Phuc H, Di Rienzi SC, Danhof HA, Zeng XL, Feagins LA, Deng N, Vilar E, McAllister F, Coarfa C, Min S, Kim HJ, Shukla R, Britton R, Estes MK, Blutt SE | 2023 Nov 1 | | 37909332 |
PMID:
37884859
Title:
Integrative genome-scale analyses reveal post-transcriptional signatures of early human small intestinal development in a directed differentiation organoid model.
Authors:
Hung YH, Capeling M, Villanueva JW, Kanke M, Shanahan MT, Huang S, Cubitt R, Rinaldi VD, Schimenti JC, Spence JR, Sethupathy P
Journal:
BMC Genomics
Publication Date:
2023 Oct 26
DOI:
https://doi.org/10.1186/s12864-023-09743-1
MeSH Terms: Humans, Animals, Mice, Gene Expression Regulation, Developmental, Cell Differentiation, MicroRNAs, Intestine, Small, Organoids
|
The small RNA-seq data generated from this study is available through GEO accession GSE207467. ChRO-seq and bulk RNA-seq data have been generated previously and available through GEO accession GSE142316. For the single cell RNA-seq analyses, the data of wild type and whole body miR-375 knockout mice is available through GSE178826 and GSE208224, respectively. We established an interactive web server called ProHumID (https://sethupathy-lab.shinyapps.io/ProHumID/) for users to explore sequencing data generated from this study.
| True | Integrative genome-scale analyses reveal post-transcriptional signatures of early human small intestinal development in a directed differentiation organoid model. | Hung YH, Capeling M, Villanueva JW, Kanke M, Shanahan MT, Huang S, Cubitt R, Rinaldi VD, Schimenti JC, Spence JR, Sethupathy P | 2023 Oct 26 | | 37884859 |
PMID:
37790430
Title:
Epithelial zonation along the mouse and human small intestine defines five discrete metabolic domains.
Authors:
Zwick RK, Kasparek P, Palikuqi B, Viragova S, Weichselbaum L, McGinnis CS, McKinley KL, Rathnayake A, Vaka D, Nguyen V, Trentesaux C, Reyes E, Gupta AR, Gartner ZJ, Locksley RM, Gardner JM, Itzkovitz S, Boffelli D, Klein OD
Journal:
bioRxiv
Publication Date:
2023 Sep 22
DOI:
pii: 2023.09.20.558726. doi: 10.1101/2023.09.20.558726
MeSH Terms: No Mesh Terms available
|
No data and code information found in the publication.
| | Epithelial zonation along the mouse and human small intestine defines five discrete metabolic domains. | Zwick RK, Kasparek P, Palikuqi B, Viragova S, Weichselbaum L, McGinnis CS, McKinley KL, Rathnayake A, Vaka D, Nguyen V, Trentesaux C, Reyes E, Gupta AR, Gartner ZJ, Locksley RM, Gardner JM, Itzkovitz S, Boffelli D, Klein OD | 2023 Sep 22 | | 37790430 |
PMID:
37643009
Title:
Epithelial TNF controls cell differentiation and CFTR activity to maintain intestinal mucin homeostasis.
Authors:
Reyes EA, Castillo-Azofeifa D, Rispal J, Wald T, Zwick RK, Palikuqi B, Mujukian A, Rabizadeh S, Gupta AR, Gardner JM, Boffelli D, Gartner ZJ, Klein OD
Journal:
J Clin Invest
Publication Date:
2023 Oct 16
DOI:
https://doi.org/10.1172/JCI163591
MeSH Terms: Humans, Animals, Mice, Mucins, Cystic Fibrosis Transmembrane Conductance Regulator, Tumor Necrosis Factor Inhibitors, Epithelial Cells, Cell Differentiation, Tumor Necrosis Factors, Homeostasis
|
Values for all data points are available in the Supporting Data Values file. FACS experiments and analysis. RKZ and BP processed and
shared human donor ileal histological samples. AM and SR generated the histological panel of IBD patient samples. ARG and JMG
procured human adult intestinal tissue from donors. DB provided
bioinformatics support. EAR, DCA, and JR wrote the manuscript.
All authors contributed to editing and review of the manuscript.
| True | Epithelial TNF controls cell differentiation and CFTR activity to maintain intestinal mucin homeostasis. | Reyes EA, Castillo-Azofeifa D, Rispal J, Wald T, Zwick RK, Palikuqi B, Mujukian A, Rabizadeh S, Gupta AR, Gardner JM, Boffelli D, Gartner ZJ, Klein OD | 2023 Oct 16 | | 37643009 |
PMID:
37403628
Title:
Understanding and Overcoming Immunosuppression Shaped by Cancer Stem Cells.
Authors:
Li L, Jensen RA
Journal:
Cancer Res
Publication Date:
2023 Jul 5
DOI:
https://doi.org/10.1158/0008-5472.CAN-23-0230
MeSH Terms: Humans, Prospective Studies, Neoplasms, Immunosuppression Therapy, Immunotherapy, Neoplastic Stem Cells, Tumor Microenvironment
|
No data and code information found in the publication.
| True | Understanding and Overcoming Immunosuppression Shaped by Cancer Stem Cells. | Li L, Jensen RA | 2023 Jul 5 | | 37403628 |
PMID:
37268690
Title:
Therapeutic blood-brain barrier modulation and stroke treatment by a bioengineered FZD(4)-selective WNT surrogate in mice.
Authors:
Ding J, Lee SJ, Vlahos L, Yuki K, Rada CC, van Unen V, Vuppalapaty M, Chen H, Sura A, McCormick AK, Tomaske M, Alwahabi S, Nguyen H, Nowatzke W, Kim L, Kelly L, Vollrath D, Califano A, Yeh WC, Li Y, Kuo CJ
Journal:
Nat Commun
Publication Date:
2023 Jun 2
DOI:
https://doi.org/10.1038/s41467-023-37689-1
MeSH Terms: Mice, Animals, Blood-Brain Barrier, Frizzled Receptors, Retina, Blood-Retinal Barrier, Wnt Signaling Pathway
|
The bulk RNA-seq and scRNA-seq data sets generated in this study have been deposited in Gene Expression Omnibus with the accession code GSE223628 and GSE223498 individually. Bulk RNA data were aligned to Ensembl mouse genome using Kallisto (v 0.44.0) with default parameters. Source data and the raw data of graphs in the figures in this study is provided in Source Data files with this paper. Other raw data are available immediately upon request. Source data are provided with this paper.
Scripts to perform analyses of scRNA-seq data are provided with this paper. Custom code is available on GitHub (https://github.com/ califano-lab/NDP-KO-SC) and on Zenodo as well http://zenodo.org/badge/latestdoi/592882572.
| True | Therapeutic blood-brain barrier modulation and stroke treatment by a bioengineered FZD(4)-selective WNT surrogate in mice. | Ding J, Lee SJ, Vlahos L, Yuki K, Rada CC, van Unen V, Vuppalapaty M, Chen H, Sura A, McCormick AK, Tomaske M, Alwahabi S, Nguyen H, Nowatzke W, Kim L, Kelly L, Vollrath D, Califano A, Yeh WC, Li Y, Kuo CJ | 2023 Jun 2 | | 37268690 |
PMID:
37425793
Title:
Patterning and folding of intestinal villi by active mesenchymal dewetting.
Authors:
Huycke TR, Miyazaki H, Häkkinen TJ, Srivastava V, Barruet E, McGinnis CS, Kalantari A, Cornwall-Scoones J, Vaka D, Zhu Q, Jo H, DeGrado WF, Thomson M, Garikipati K, Boffelli D, Klein OD, Gartner ZJ
Journal:
bioRxiv
Publication Date:
2023 Aug 15
DOI:
pii: 2023.06.25.546328. doi: 10.1101/2023.06.25.546328
MeSH Terms: No Mesh Terms available
|
| True | Patterning and folding of intestinal villi by active mesenchymal dewetting. | Huycke TR, Miyazaki H, Häkkinen TJ, Srivastava V, Barruet E, McGinnis CS, Kalantari A, Cornwall-Scoones J, Vaka D, Zhu Q, Jo H, DeGrado WF, Thomson M, Garikipati K, Boffelli D, Klein OD, Gartner ZJ | 2023 Aug 15 | | 37425793 |
PMID:
37070767
Title:
Transplanted human intestinal organoids: a resource for modeling human intestinal development.
Authors:
Singh A, Poling HM, Chaturvedi P, Thorner K, Sundaram N, Kechele DO, Childs CJ, McCauley HA, Fisher GW, Brown NE, Spence JR, Wells JM, Helmrath MA
Journal:
Development
Publication Date:
2023 May 1
DOI:
https://doi.org/10.1242/dev.201416
MeSH Terms: Animals, Humans, Intestines, Intestinal Mucosa, Organoids, Pluripotent Stem Cells, Cell Differentiation
|
All sequencing data in this paper can be viewed at: https://research.cchmc.org/Shiny-Akaljot/. Raw files of all single nucleus datasets generated as part of this work are available in Gene Expression Omnibus under accession number GSE226925. Raw files for the single-cell sequencing that was performed on tHIOs are available in Gene Expression Omnibus under accession number GSE214852. Raw files that were used in the construction of the reference atlas are available in ArrayExpress under accession numbers E-MTAB-8901 and E-MTAB-10187 and in Gene Expression Omnibus under accession number GSE158702.
| True | Transplanted human intestinal organoids: a resource for modeling human intestinal development. | Singh A, Poling HM, Chaturvedi P, Thorner K, Sundaram N, Kechele DO, Childs CJ, McCauley HA, Fisher GW, Brown NE, Spence JR, Wells JM, Helmrath MA | 2023 May 1 | | 37070767 |
PMID:
36703617
Title:
Transferrin Receptor-Mediated Iron Uptake Promotes Colon Tumorigenesis.
Authors:
Kim H, Villareal LB, Liu Z, Haneef M, Falcon DM, Martin DR, Lee HJ, Dame MK, Attili D, Chen Y, Varani J, Spence JR, Kovbasnjuk O, Colacino JA, Lyssiotis CA, Lin HC, Shah YM, Xue X
Journal:
Adv Sci (Weinh)
Publication Date:
2023 Apr
DOI:
https://doi.org/10.1002/advs.202207693
MeSH Terms: Humans, beta Catenin, Iron, Tankyrases, Colonic Neoplasms, Carcinogenesis, Cell Transformation, Neoplastic, Receptors, Transferrin
|
The data that support the findings of this study are available from the corresponding author upon reasonable request.
| True | Transferrin Receptor-Mediated Iron Uptake Promotes Colon Tumorigenesis. | Kim H, Villareal LB, Liu Z, Haneef M, Falcon DM, Martin DR, Lee HJ, Dame MK, Attili D, Chen Y, Varani J, Spence JR, Kovbasnjuk O, Colacino JA, Lyssiotis CA, Lin HC, Shah YM, Xue X | 2023 Apr | | 36703617 |
PMID:
37028407
Title:
Graded BMP signaling within intestinal crypt architecture directs self-organization of the Wnt-secreting stem cell niche.
Authors:
Kraiczy J, McCarthy N, Malagola E, Tie G, Madha S, Boffelli D, Wagner DE, Wang TC, Shivdasani RA
Journal:
Cell Stem Cell
Publication Date:
2023 Apr 6
DOI:
https://doi.org/10.1016/j.stem.2023.03.004
MeSH Terms: Animals, Mice, Intestinal Mucosa, Stem Cell Niche, Intestines, Signal Transduction, Cell Differentiation, Cell Proliferation
|
Sequencing data have been deposited in the Gene Expression Omnibus (GEO) repository under the accession numbers GSE211275 and GSE212601 as listed in the Key Resources Table. Data are publicly available as of the date of publication. This study includes analysis of previously published data, referenced with the accession numbers in the Key Resources Table. This study used custom functions in a Python environment (3.7.13) available at Zenodo, DOI:10.5281/zenodo.7686568 Any additional information required to reanalyze data reported in this paper is available from the lead contact upon request.
| | Graded BMP signaling within intestinal crypt architecture directs self-organization of the Wnt-secreting stem cell niche. | Kraiczy J, McCarthy N, Malagola E, Tie G, Madha S, Boffelli D, Wagner DE, Wang TC, Shivdasani RA | 2023 Apr 6 | | 37028407 |
PMID:
36912192
Title:
Fibroblast-derived EGF ligand neuregulin 1 induces fetal-like reprogramming of the intestinal epithelium without supporting tumorigenic growth.
Authors:
Lemmetyinen TT, Viitala EW, Wartiovaara L, Kaprio T, Hagström J, Haglund C, Katajisto P, Wang TC, Domènech-Moreno E, Ollila S
Journal:
Dis Model Mech
Publication Date:
2023 Apr 1
DOI:
https://doi.org/10.1242/dmm.049692
MeSH Terms: Humans, Carcinogenesis, Epidermal Growth Factor, Fibroblasts, Intestinal Mucosa, Ligands, Neuregulin-1, Cellular Reprogramming
|
RNA sequencing data have been deposited at the Gene Expression Omnibus under the accession number GSE200704.
| True | Fibroblast-derived EGF ligand neuregulin 1 induces fetal-like reprogramming of the intestinal epithelium without supporting tumorigenic growth. | Lemmetyinen TT, Viitala EW, Wartiovaara L, Kaprio T, Hagström J, Haglund C, Katajisto P, Wang TC, Domènech-Moreno E, Ollila S | 2023 Apr 1 | | 36912192 |
PMID:
36924771
Title:
Smooth muscle contributes to the development and function of a layered intestinal stem cell niche.
Authors:
McCarthy N, Tie G, Madha S, He R, Kraiczy J, Maglieri A, Shivdasani RA
Journal:
Dev Cell
Publication Date:
2023 Apr 10
DOI:
https://doi.org/10.1016/j.devcel.2023.02.012
MeSH Terms: Humans, Mice, Animals, Stem Cell Niche, Intestines, Intestinal Mucosa, Cell Differentiation, Bone Morphogenetic Proteins, Muscle, Smooth
|
Data are deposited in the Gene Expression Omnibus (GSE184158). No new software was developed for this study. Any additional information required to reanalyze the data reported in this work paper is available from the Lead Contact upon request.
| | Smooth muscle contributes to the development and function of a layered intestinal stem cell niche. | McCarthy N, Tie G, Madha S, He R, Kraiczy J, Maglieri A, Shivdasani RA | 2023 Apr 10 | | 36924771 |
PMID:
36634827
Title:
F4/80(+)Ly6C(high) Macrophages Lead to Cell Plasticity and Cancer Initiation in Colitis.
Authors:
Shin AE, Tesfagiorgis Y, Larsen F, Derouet M, Zeng PYF, Good HJ, Zhang L, Rubinstein MR, Han YW, Kerfoot SM, Nichols AC, Hayakawa Y, Howlett CJ, Wang TC, Asfaha S
Journal:
Gastroenterology
Publication Date:
2023 Apr
DOI:
https://doi.org/10.1053/j.gastro.2023.01.002
MeSH Terms: Animals, Mice, Azoxymethane, Carcinogenesis, Cell Plasticity, Colitis, Colitis-Associated Neoplasms, Dextran Sulfate, Disease Models, Animal, Inflammation, Macrophages, Mice, Inbred C57BL
|
RNA-sequencing matrix files have been deposited in the National Institutes of Health Gene
Expression Omnibus database and can be accessed at PRJNA910503. All data are available
in the main text or the Supplementary Materials.
| | F4/80(+)Ly6C(high) Macrophages Lead to Cell Plasticity and Cancer Initiation in Colitis. | Shin AE, Tesfagiorgis Y, Larsen F, Derouet M, Zeng PYF, Good HJ, Zhang L, Rubinstein MR, Han YW, Kerfoot SM, Nichols AC, Hayakawa Y, Howlett CJ, Wang TC, Asfaha S | 2023 Apr | | 36634827 |
PMID:
36779454
Title:
An Engineered Living Intestinal Muscle Patch Produces Macroscopic Contractions that can Mix and Break Down Artificial Intestinal Contents.
Authors:
Wang Q, Wang J, Tokhtaeva E, Li Z, Martín MG, Ling XB, Dunn JCY
Journal:
Adv Mater
Publication Date:
2023 Apr
DOI:
https://doi.org/10.1002/adma.202207255
MeSH Terms: Humans, Muscle, Smooth, Gastrointestinal Contents, Intestines, Tissue Engineering, Muscle Contraction, Biological Factors
|
RNA-seq data have been submitted to the NCBI GEO under the accession number GSE223116. Further information and requests for data should be directed to the corresponding authors.
| | An Engineered Living Intestinal Muscle Patch Produces Macroscopic Contractions that can Mix and Break Down Artificial Intestinal Contents. | Wang Q, Wang J, Tokhtaeva E, Li Z, Martín MG, Ling XB, Dunn JCY | 2023 Apr | | 36779454 |
PMID:
37090649
Title:
deMULTIplex2: robust sample demultiplexing for scRNA-seq.
Authors:
Zhu Q, Conrad DN, Gartner ZJ
Journal:
bioRxiv
Publication Date:
2023 Apr 12
DOI:
pii: 2023.04.11.536275. doi: 10.1101/2023.04.11.536275
MeSH Terms: No Mesh Terms available
|
| True | deMULTIplex2: robust sample demultiplexing for scRNA-seq. | Zhu Q, Conrad DN, Gartner ZJ | 2023 Apr 12 | | 37090649 |
PMID:
36821371
Title:
EPIREGULIN creates a developmental niche for spatially organized human intestinal enteroids.
Authors:
Childs CJ, Holloway EM, Sweet CW, Tsai YH, Wu A, Vallie A, Eiken MK, Capeling MM, Zwick RK, Palikuqi B, Trentesaux C, Wu JH, Pellón-Cardenas O, Zhang CJ, Glass I, Loebel C, Yu Q, Camp JG, Sexton JZ, Klein OD, Verzi MP, Spence JR
Journal:
JCI Insight
Publication Date:
2023 Mar 22
DOI:
https://doi.org/10.1172/jci.insight.165566
MeSH Terms: Humans, Epidermal Growth Factor, Epiregulin, Intestines, Intestinal Mucosa, Cell Differentiation
|
Sequencing data generated and used by this study are deposited at EMBL-EBI ArrayExpress. Data sets for human fetal intestine (ArrayExpress: E-MTAB-9489, and previously published work: ref. 13), scRNA-Seq of human fetal intestinal enteroids (ArrayExpress: E-MTAB-11912), and dual snRNA/snATAC-Seq multiomic data of human fetal intestinal enteroids (ArrayExpress: E-MTAB-11908) have been deposited. Code used to process raw data can be found at https://github.com/jason-spence-lab/Childs_2022 (commit ID c8bd5a7).
| True | EPIREGULIN creates a developmental niche for spatially organized human intestinal enteroids. | Childs CJ, Holloway EM, Sweet CW, Tsai YH, Wu A, Vallie A, Eiken MK, Capeling MM, Zwick RK, Palikuqi B, Trentesaux C, Wu JH, Pellón-Cardenas O, Zhang CJ, Glass I, Loebel C, Yu Q, Camp JG, Sexton JZ, Klein OD, Verzi MP, Spence JR | 2023 Mar 22 | | 36821371 |
PMID:
36640764
Title:
A DLG1-ARHGAP31-CDC42 axis is essential for the intestinal stem cell response to fluctuating niche Wnt signaling.
Authors:
Castillo-Azofeifa D, Wald T, Reyes EA, Gallagher A, Schanin J, Vlachos S, Lamarche-Vane N, Bomidi C, Blutt S, Estes MK, Nystul T, Klein OD
Journal:
Cell Stem Cell
Publication Date:
2023 Feb 2
DOI:
https://doi.org/10.1016/j.stem.2022.12.008
MeSH Terms: Animals, Mice, Cell Proliferation, GTPase-Activating Proteins, Intestinal Mucosa, Intestines, Stem Cell Niche, Stem Cells, Wnt Signaling Pathway
|
Bulk RNA-seq data have been deposited at GEO and are publicly available as of the date of publication. Accession numbers are listed in the key resources table. Microscopy data reported in this paper will be shared by the lead contact upon request. This paper does not report original code. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
| | A DLG1-ARHGAP31-CDC42 axis is essential for the intestinal stem cell response to fluctuating niche Wnt signaling. | Castillo-Azofeifa D, Wald T, Reyes EA, Gallagher A, Schanin J, Vlachos S, Lamarche-Vane N, Bomidi C, Blutt S, Estes MK, Nystul T, Klein OD | 2023 Feb 2 | | 36640764 |
PMID:
36798304
Title:
Defining the structure, signals, and cellular elements of the gastric mesenchymal niche.
Authors:
Manieri E, Tie G, Seruggia D, Madha S, Maglieri A, Huang K, Fujiwara Y, Zhang K, Orkin SH, He R, McCarthy N, Shivdasani RA
Journal:
bioRxiv
Publication Date:
2023 Feb 24
DOI:
pii: 2023.02.11.527728. doi: 10.1101/2023.02.11.527728
MeSH Terms: No Mesh Terms available
|
Sequencing data have been deposited in the Gene Expression Omnibus (GEO) repository under the accession numbers listed in the Key Resources Table. Data will be publicly available as of the date of publication. This study includes analysis of previously published data, referenced with the accession numbers in the Key Resources Table. Any additional information required to reanalyze data reported in this paper is available from the lead contact upon request.
| | Defining the structure, signals, and cellular elements of the gastric mesenchymal niche. | Manieri E, Tie G, Seruggia D, Madha S, Maglieri A, Huang K, Fujiwara Y, Zhang K, Orkin SH, He R, McCarthy N, Shivdasani RA | 2023 Feb 24 | | 36798304 |
PMID:
36702898
Title:
In vivo development of immune tissue in human intestinal organoids transplanted into humanized mice.
Authors:
Bouffi C, Wikenheiser-Brokamp KA, Chaturvedi P, Sundaram N, Goddard GR, Wunderlich M, Brown NE, Staab JF, Latanich R, Zachos NC, Holloway EM, Mahe MM, Poling HM, Vales S, Fisher GW, Spence JR, Mulloy JC, Zorn AM, Wells JM, Helmrath MA
Journal:
Nat Biotechnol
Publication Date:
2023 Jun
DOI:
https://doi.org/10.1038/s41587-022-01558-x
MeSH Terms: Humans, Animals, Mice, Intestines, Intestinal Mucosa, Organoids, Pluripotent Stem Cells, Transplants
|
| True | In vivo development of immune tissue in human intestinal organoids transplanted into humanized mice. | Bouffi C, Wikenheiser-Brokamp KA, Chaturvedi P, Sundaram N, Goddard GR, Wunderlich M, Brown NE, Staab JF, Latanich R, Zachos NC, Holloway EM, Mahe MM, Poling HM, Vales S, Fisher GW, Spence JR, Mulloy JC, Zorn AM, Wells JM, Helmrath MA | 2023 Jun | | 36702898 |
PMID:
36711781
Title:
TGFB1 Induces Fetal Reprogramming and Enhances Intestinal Regeneration.
Authors:
Chen L, Dupre A, Qiu X, Pellon-Cardenas O, Walton KD, Wang J, Perekatt AO, Hu W, Spence JR, Verzi MP
Journal:
bioRxiv
Publication Date:
2023 Jan 13
DOI:
pii: 2023.01.13.523825. doi: 10.1101/2023.01.13.523825
MeSH Terms: No Mesh Terms available
|
All RNA-seq, scRNA-seq and ATAC-seq data of this study have been deposited in GEO (GSE222505). The following datasets from GEO were reanalyzed with our sequencing data: the accession number for the SMAD4 ChIP in mouse intestinal epithelium from our previous studies is GSE112946 (Chen et al., 2019). Bulk RNA-seq of GSE165157 (Qu et al., 2021) was used to analyze crypt transcriptome upon IR at days 0, 1, 2, 3 and 5. scRNA-seq of GSE117783 (Ayyaz et al., 2019) was used to compare normal crypts and irradiated crypt cells after 3 days of irradiation. scRNA-seq of GSE165318 was used to analyze duodenum/jejunum boundary samples collected at days 0, 1, 3, 7, and 14 after irradiation. scRNA-seq of GSE145866 (Sheng et al., 2020) was used to analyze sorted Msi1-GFP positive cells (irradiation-resistant) and their progeny cells upon irradiation.
| True | TGFB1 Induces Fetal Reprogramming and Enhances Intestinal Regeneration. | Chen L, Dupre A, Qiu X, Pellon-Cardenas O, Walton KD, Wang J, Perekatt AO, Hu W, Spence JR, Verzi MP | 2023 Jan 13 | | 36711781 |
PMID:
36317629
Title:
R-spondin 3 governs secretory differentiation in the gastric oxyntic glands.
Authors:
Kurokawa K, Wang TC, Hayakawa Y
Journal:
J Clin Invest
Publication Date:
2022 Nov 1
DOI:
https://doi.org/10.1172/JCI163380
MeSH Terms: Mice, Animals, Gastric Mucosa, Cell Differentiation, Stem Cells, Organoids, Stem Cell Niche
|
No data and code information found in the publication.
| True | R-spondin 3 governs secretory differentiation in the gastric oxyntic glands. | Kurokawa K, Wang TC, Hayakawa Y | 2022 Nov 1 | | 36317629 |
PMID:
36214410
Title:
Approaches to benchmark and characterize in vitro human model systems.
Authors:
Childs CJ, Eiken MK, Spence JR
Journal:
Development
Publication Date:
2022 Oct 15
DOI:
https://doi.org/10.1242/dev.200641
MeSH Terms: Benchmarking, Humans, Organogenesis, Organoids
|
No data and code information found in the publication.
| | Approaches to benchmark and characterize in vitro human model systems. | Childs CJ, Eiken MK, Spence JR | 2022 Oct 15 | | 36214410 |
PMID:
35803312
Title:
Using Human Induced Pluripotent Stem Cell-Derived Organoids to Identify New Pathologies in Patients With PDX1 Mutations.
Authors:
Krishnamurthy M, Kechele DO, Broda T, Zhang X, Enriquez JR, McCauley HA, Sanchez JG, McCracken K, Palermo J, Bernieh A, Collins MH, Thomas IH, Neef HC, Heider A, Dauber A, Wells JM
Journal:
Gastroenterology
Publication Date:
2022 Oct
DOI:
https://doi.org/10.1053/j.gastro.2022.06.083
MeSH Terms: Cell Differentiation, Humans, Induced Pluripotent Stem Cells, Metaplasia, Mutation, Organoids, Stomach
|
No data and code information found in the publication.
| | Using Human Induced Pluripotent Stem Cell-Derived Organoids to Identify New Pathologies in Patients With PDX1 Mutations. | Krishnamurthy M, Kechele DO, Broda T, Zhang X, Enriquez JR, McCauley HA, Sanchez JG, McCracken K, Palermo J, Bernieh A, Collins MH, Thomas IH, Neef HC, Heider A, Dauber A, Wells JM | 2022 Oct | | 35803312 |
PMID:
36191054
Title:
Human neutrophil IL1ß directs intestinal epithelial cell extrusion during Salmonella infection.
Authors:
Lawrence AE, Berger RP, Hill DR, Huang S, Yadagiri VK, Bons B, Fields C, Sule GJ, Knight JS, Wobus CE, Spence JR, Young VB, O'Riordan MX, Abuaita BH
Journal:
PLoS Pathog
Publication Date:
2022 Oct
DOI:
https://doi.org/10.1371/journal.ppat.1010855
MeSH Terms: Animals, Humans, Mice, Caspases, Epithelial Cells, Intestinal Mucosa, Neutrophils, Salmonella Infections, Salmonella typhimurium
|
| True | Human neutrophil IL1ß directs intestinal epithelial cell extrusion during Salmonella infection. | Lawrence AE, Berger RP, Hill DR, Huang S, Yadagiri VK, Bons B, Fields C, Sule GJ, Knight JS, Wobus CE, Spence JR, Young VB, O'Riordan MX, Abuaita BH | 2022 Oct | | 36191054 |
PMID:
35919990
Title:
Orthovoltage X-Rays Exhibit Increased Efficacy Compared with ?-Rays in Preclinical Irradiation.
Authors:
Bell BI, Vercellino J, Brodin NP, Velten C, Nanduri LSY, Nagesh PKB, Tanaka KE, Fang Y, Wang Y, Macedo R, English J, Schumacher MM, Duddempudi PK, Asp P, Koba W, Shajahan S, Liu L, Tomé WA, Yang WL, Kolesnick R, Guha C
Journal:
Cancer Res
Publication Date:
2022 Aug 3
DOI:
https://doi.org/10.1158/0008-5472.CAN-22-0656
MeSH Terms: Animals, Cesium Radioisotopes, Gamma Rays, Mice, Whole-Body Irradiation, X-Rays
|
The data generated in this study are available upon request from the corresponding author.
| | Orthovoltage X-Rays Exhibit Increased Efficacy Compared with ?-Rays in Preclinical Irradiation. | Bell BI, Vercellino J, Brodin NP, Velten C, Nanduri LSY, Nagesh PKB, Tanaka KE, Fang Y, Wang Y, Macedo R, English J, Schumacher MM, Duddempudi PK, Asp P, Koba W, Shajahan S, Liu L, Tomé WA, Yang WL, Kolesnick R, Guha C | 2022 Aug 3 | | 35919990 |
PMID:
35931034
Title:
Lymphangiocrine signals are required for proper intestinal repair after cytotoxic injury.
Authors:
Palikuqi B, Rispal J, Reyes EA, Vaka D, Boffelli D, Klein O
Journal:
Cell Stem Cell
Publication Date:
2022 Aug 4
DOI:
https://doi.org/10.1016/j.stem.2022.07.007
MeSH Terms: Cell Proliferation, Endothelial Cells, Epithelial Cells, Intestinal Mucosa, Intestines, Stem Cells
|
All scRNAseq data have been deposited on the Gene Expression Omnibus (GEO) and can be viewed under accession number GSE198469. This manuscript did not generate any new code. Any additional information required to reanalyze the data reported in this work is available from the lead contact upon request.
| | Lymphangiocrine signals are required for proper intestinal repair after cytotoxic injury. | Palikuqi B, Rispal J, Reyes EA, Vaka D, Boffelli D, Klein O | 2022 Aug 4 | | 35931034 |
PMID:
35905739
Title:
Aggregation of cryopreserved mid-hindgut endoderm for more reliable and reproducible hPSC-derived small intestinal organoid generation.
Authors:
Pitstick AL, Poling HM, Sundaram N, Lewis PL, Kechele DO, Sanchez JG, Scott MA, Broda TR, Helmrath MA, Wells JM, Mayhew CN
Journal:
Stem Cell Reports
Publication Date:
2022 Aug 9
DOI:
https://doi.org/10.1016/j.stemcr.2022.06.011
MeSH Terms: Cell Differentiation, Endoderm, Humans, Intestine, Small, Organoids, Pluripotent Stem Cells
|
| True | Aggregation of cryopreserved mid-hindgut endoderm for more reliable and reproducible hPSC-derived small intestinal organoid generation. | Pitstick AL, Poling HM, Sundaram N, Lewis PL, Kechele DO, Sanchez JG, Scott MA, Broda TR, Helmrath MA, Wells JM, Mayhew CN | 2022 Aug 9 | | 35905739 |
PMID:
35767358
Title:
R-spondin signaling in the stomach: isthmal Lgr4 rules.
Authors:
Malagola E, Hayakawa Y, Wang TC
Journal:
EMBO J
Publication Date:
2022 Jul 4
DOI:
https://doi.org/10.15252/embj.2022111696
MeSH Terms: Receptors, G-Protein-Coupled, Signal Transduction, Stem Cells, Stomach, Thrombospondins, Wnt Signaling Pathway
|
No data and code information found in the publication.
| | R-spondin signaling in the stomach: isthmal Lgr4 rules. | Malagola E, Hayakawa Y, Wang TC | 2022 Jul 4 | | 35767358 |